p38 (CRK) (NM_016823) Human Untagged Clone

CAT#: SC324918

CRK (untagged)-Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant II

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRK
• Synonyms: CRKII; p38
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_016823, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGAGGTTGAGTCGGCAGGAGGCGG
  TGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGACTA
  TGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCGCGCCCGCCG
  GTGCCACCGTCGCCCGCCCAGCCTCCGCCCGGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGT
  TTGATTCATTGCCTGCTTTACTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACC
  AGTTTCCAGATCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTC
  TTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGAATCCGGGACA
  AGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGGATGATTCCAGTCCCTTACGT
  CGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTGATTGGAGGTAACCAGGAGGGTTCCCACCCA
  CAGCCACTGGGTGGGCCGGAGCCTGGGCCCTATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCC
  AGAATGGGCCCATATATGCCAGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAGACAGCCTTGGC
  TTTGGAGGTCGGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAAT
  GGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGATGAGGACTTCA
  GCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_016823
• ORF Size: 915 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_016823.3, NP_058431.2
• RefSeq Size: 3225
• RefSeq ORF: 915
• Locus ID: 1398
• Domains: SH2, SH3
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Chemokine signaling pathway, Chronic myeloid leukemia, ErbB signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Insulin signaling pathway, MAPK signaling pathway, Neurotrophin signaling pathway, Pathways in cancer, Regulation of actin cytoskeleton, Renal cell carcinoma
• Gene Summary: This gene encodes a member of an adapter protein family that binds to several tyrosine-phosphorylated proteins. The product of this gene has several SH2 and SH3 domains (src-homology domains) and is involved in several signaling pathways, recruiting cytoplasmic proteins in the vicinity of tyrosine kinase through SH2-phosphotyrosine interaction. The N-terminal SH2 domain of this protein functions as a positive regulator of transformation whereas the C-terminal SH3 domain functions as a negative regulator of transformation. Two alternative transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (II) includes an alternate segment, compared to variant I, resulting in a longer protein (isoform a) that has a distinct C-terminus and an additional SH3 domain, compared to isoform b. Isoform a is a negative modulator of transformation activity.