SEC13L1 (SEC13) (NM_001136232) Human Untagged Clone
CAT#: SC324922
SEC13 (untagged)-Human SEC13 homolog (S. cerevisiae) (SEC13), transcript variant 2
"NM_001136232" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SEC13 |
Synonyms | D3S1231E; npp-20; SEC13L1; SEC13R |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001136232, the custom clone sequence may differ by one or more nucleotides
ATGATTCACGACGCCCAGATGGACTACTATGGCACCCGCCTGGCAACCTGCTCATCAGACAGGTCCGTCA AAATCTTTGATGTGCGCAATGGAGGGCAGATCCTTATCGCCGACCTCAGGGGTCATGAGGGTCCTGTGTG GCAAGTGGCCTGGGCTCACCCCATGTACGGCAACATCCTGGCATCGTGCTCCTATGACCGGAAAGTCATT ATCTGGAGAGAGGAAAACGGCACCTGGGAGAAGAGCCACGAGCATGCGGGACACGACTCCTCAGTGAACT CGGTGTGCTGGGCCCCCCATGACTACGGCCTGATCCTGGCCTGTGGGAGCTCGGATGGGGCCATCTCCCT GCTGACTTACACCGGGGAAGGCCAATGGGAAGTAAAGAAGATCAACAACGCTCACACCATTGGCTGCAAT GCCGTCAGCTGGGCCCCTGCTGTTGTACCTGGAAGCCTCATAGACCACCCATCGGGGCAGAAACCCAATT ACATCAAGAGGTTTGCATCAGGTGGCTGTGACAACCTCATCAAGCTGTGGAAGGAGGAGGAGGACGGCCA GTGGAAGGAGGAGCAGAAGCTAGAAGCGCACAGTGACTGGGTTCGAGATGTGGCCTGGGCCCCCTCCATC GGCCTGCCCACCAGCACCATCGCCAGCTGCTCCCAGGATGGTCGTGTGTTCATTTGGACCTGTGATGATG CCTCAAGCAATACGTGGTCCCCTAAATTGTTGCACAAGTTCAACGATGTGGTGTGGCATGTGAGCTGGTC CATCACAGCCAACATCCTGGCTGTCTCTGGTGGAGACAATAAGGTGACCCTGTGGAAGGAGTCAGTTGAT GGGCAGTGGGTGTGCATCAGTGATGTCAACAAGGGCCAGGGCTCCGTATCAGCATCAGTGACAGAGGGCC AGCAGAACGAGCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001136232 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001136232.2, NP_001129704.1 |
RefSeq Size | 1469 bp |
RefSeq ORF | 927 bp |
Locus ID | 6396 |
Cytogenetics | 3p25.3 |
Gene Summary | 'The protein encoded by this gene belongs to the SEC13 family of WD-repeat proteins. It is a constituent of the endoplasmic reticulum and the nuclear pore complex. It has similarity to the yeast SEC13 protein, which is required for vesicle biogenesis from endoplasmic reticulum during the transport of proteins. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2008]' Transcript Variant: This variant (2) differs in the 5' UTR and the 5' coding region, and initiates translation at a downstream start codon compared to variant 3. It encodes isoform 2 which has a shorter N-terminus, compared to isoform 3. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226933 | SEC13 (Myc-DDK-tagged)-Human SEC13 homolog (S. cerevisiae) (SEC13), transcript variant 2 |
USD 420.00 |
|
RG226933 | SEC13 (GFP-tagged) - Human SEC13 homolog (S. cerevisiae) (SEC13), transcript variant 2 |
USD 460.00 |
|
RC226933L3 | Lenti ORF clone of Human SEC13 homolog (S. cerevisiae) (SEC13), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC226933L4 | Lenti ORF clone of Human SEC13 homolog (S. cerevisiae) (SEC13), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review