NFYC (NM_001142587) Human Untagged Clone

CAT#: SC324953

NFYC (untagged)-Human nuclear transcription factor Y, gamma (NFYC), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NFYC
• Synonyms: CBF-C; CBFC; H1TF2A; HAP5; HSM; NF-YC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142587, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAGTCGTTCTGGC
  CTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTGCAGGAACTCCCACTGGCTCG
  TATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATGATCAGTGCAGAAGCGCCTGTACTCTTTGCC
  AAGGCAGCCCAGATTTTTATCACAGAGTTGACTCTTCGAGCCTGGATTCACACAGAAGATAACAAGCGCC
  GGACTCTACAGAGAAATGATATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATCGATAT
  TGTTCCAAGAGATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCTGCCGAG
  CCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTCCAGGGCCAGCAGCAAGGCC
  AGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATCGCACAGCCTCAGCAGGGCCA
  GACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAGCAGGTGCAGATTGTCCAGGCTCAGCCACAGGGT
  CAAGCCCAACAGGCCCAGAGTGGCACTGGACAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAG
  GAGAGATCCAGCAGATCCCGGTGCAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGT
  ATCAGGCACTCAAGTTGTGCAGGGACAGATCCAGACACTTGCCACCAATGCTCAACAGATTACACAGACA
  GAGGTCCAGCAAGGACAGCAGCAGTTCAGCCAGTTCACAGATGGACAGCTCTACCAGATCCAGCAAGTCA
  CCATGCCTGCGGGCCAGGACCTCGCCCAGCCCATGTTCATCCAGTCAGCCAACCAGCCCTCCGACGGGCA
  GGCCCCCCAGGTGACCGGCGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142587
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001142587.1, NP_001136059.1
• RefSeq Size: 2102 bp
• RefSeq ORF: 1005 bp
• Locus ID: 4802
• Cytogenetics: 1p34.2
• Protein Families: Transcription Factors
• Protein Pathways: Antigen processing and presentation
• Gene Summary: 'This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]'
  Transcript Variant: This variant (3) lacks an alternate in-frame exon and uses an alternate splice site in the 3' coding region, compared to variant 1. The resulting isoform (3) has the same N- and C- termini but lacks an internal segment and one residue near the C-terminus, compared to isoform 1.