IRAK4 (NM_001145256) Human Untagged Clone
CAT#: SC324956
IRAK4 (untagged)-Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 3
"NM_001145256" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IRAK4 |
Synonyms | IPD1; IRAK-4; NY-REN-64; REN64 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145256, the custom clone sequence may differ by one or more nucleotides
ATGCCTTTCTGTGACAAAGACAGGACATTGATGACACCTGTGCAGAATCTTGAACAAAGC TATATGCCACCTGACTCCTCAAGTCCAGAAAATAAAAGTTTAGAAGTTAGTGATACACGT TTTCACAGTTTTTCATTTTATGAATTGAAGAATGTCACAAATAACTTTGATGAACGACCC ATTTCTGTTGGTGGTAATAAAATGGGAGAGGGAGGATTTGGAGTTGTATATAAAGGCTAC GTAAATAACACAACTGTGGCAGTGAAGAAGCTTGCAGCAATGGTTGACATTACTACTGAA GAACTGAAACAGCAGTTTGATCAAGAAATAAAAGTAATGGCAAAGTGTCAACATGAAAAC TTAGTAGAACTACTTGGTTTCTCAAGTGATGGAGATGACCTCTGCTTAGTATATGTTTAC ATGCCTAATGGTTCATTGCTAGACAGACTCTCTTGCTTGGATGGTACTCCACCACTTTCT TGGCACATGAGATGCAAGATTGCTCAGGGTGCAGCTAATGGCATCAATTTTCTACATGAA AATCATCATATTCATAGAGATATTAAAAGTGCAAATATCTTACTGGATGAAGCTTTTACT GCTAAAATATCTGACTTTGGCCTTGCACGGGCTTCTGAGAAGTTTGCCCAGACAGTCATG ACTAGCAGAATTGTGGGAACAACAGCTTATATGGCACCAGAAGCTTTGCGTGGAGAAATA ACACCCAAATCTGATATTTACAGCTTTGGTGTGGTTTTACTAGAAATAATAACTGGACTT CCAGCTGTGGATGAACACCGTGAACCTCAGTTATTGCTAGATATTAAAGAAGAAATTGAA GATGAAGAAAAGACAATTGAAGATTATATTGATAAAAAGATGAATGATGCTGATTCCACT TCAGTTGAAGCTATGTACTCTGTTGCTAGTCAATGTCTGCATGAAAAGAAAAATAAGAGA CCAGACATTAAGAAGGTTCAACAGCTGCTGCAAGAGATGACAGCTTCT |
Restriction Sites | Please inquire |
ACCN | NM_001145256 |
ORF Size | 1011 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001145256.1, NP_001138728.1 |
RefSeq Size | 4205 |
RefSeq ORF | 1011 |
Locus ID | 51135 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Apoptosis, Neurotrophin signaling pathway, Toll-like receptor signaling pathway |
Gene Summary | This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) lacks an alternate exon and uses a downstream start codon, compared to variant 1. The resulting isoform (b), also known as the short form, has a shorter N-terminus, compared to isoform a. Variants 3-10 all encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227336 | IRAK4 (Myc-DDK-tagged)-Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 3 |
USD 480.00 |
|
RG227336 | IRAK4 (GFP-tagged) - Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 3 |
USD 530.00 |
|
RC227336L3 | Lenti-ORF clone of IRAK4 (Myc-DDK-tagged)-Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 3 |
USD 680.00 |
|
RC227336L4 | Lenti-ORF clone of IRAK4 (mGFP-tagged)-Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 3 |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review