IRAK4 (NM_001145256) Human Untagged Clone

CAT#: SC324956

IRAK4 (untagged)-Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 3


  "NM_001145256" in other vectors (4)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "IRAK4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IRAK4
Synonyms IPD1; IRAK-4; NY-REN-64; REN64
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145256, the custom clone sequence may differ by one or more nucleotides
ATGCCTTTCTGTGACAAAGACAGGACATTGATGACACCTGTGCAGAATCTTGAACAAAGC
TATATGCCACCTGACTCCTCAAGTCCAGAAAATAAAAGTTTAGAAGTTAGTGATACACGT
TTTCACAGTTTTTCATTTTATGAATTGAAGAATGTCACAAATAACTTTGATGAACGACCC
ATTTCTGTTGGTGGTAATAAAATGGGAGAGGGAGGATTTGGAGTTGTATATAAAGGCTAC
GTAAATAACACAACTGTGGCAGTGAAGAAGCTTGCAGCAATGGTTGACATTACTACTGAA
GAACTGAAACAGCAGTTTGATCAAGAAATAAAAGTAATGGCAAAGTGTCAACATGAAAAC
TTAGTAGAACTACTTGGTTTCTCAAGTGATGGAGATGACCTCTGCTTAGTATATGTTTAC
ATGCCTAATGGTTCATTGCTAGACAGACTCTCTTGCTTGGATGGTACTCCACCACTTTCT
TGGCACATGAGATGCAAGATTGCTCAGGGTGCAGCTAATGGCATCAATTTTCTACATGAA
AATCATCATATTCATAGAGATATTAAAAGTGCAAATATCTTACTGGATGAAGCTTTTACT
GCTAAAATATCTGACTTTGGCCTTGCACGGGCTTCTGAGAAGTTTGCCCAGACAGTCATG
ACTAGCAGAATTGTGGGAACAACAGCTTATATGGCACCAGAAGCTTTGCGTGGAGAAATA
ACACCCAAATCTGATATTTACAGCTTTGGTGTGGTTTTACTAGAAATAATAACTGGACTT
CCAGCTGTGGATGAACACCGTGAACCTCAGTTATTGCTAGATATTAAAGAAGAAATTGAA
GATGAAGAAAAGACAATTGAAGATTATATTGATAAAAAGATGAATGATGCTGATTCCACT
TCAGTTGAAGCTATGTACTCTGTTGCTAGTCAATGTCTGCATGAAAAGAAAAATAAGAGA
CCAGACATTAAGAAGGTTCAACAGCTGCTGCAAGAGATGACAGCTTCT
Restriction Sites Please inquire     
ACCN NM_001145256
ORF Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145256.1, NP_001138728.1
RefSeq Size 4205
RefSeq ORF 1011
Locus ID 51135
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Apoptosis, Neurotrophin signaling pathway, Toll-like receptor signaling pathway
Gene Summary This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) lacks an alternate exon and uses a downstream start codon, compared to variant 1. The resulting isoform (b), also known as the short form, has a shorter N-terminus, compared to isoform a. Variants 3-10 all encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.