NFKBIL1 (NM_001144961) Human Untagged Clone

CAT#: SC325005

NFKBIL1 (untagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 (NFKBIL1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NFKBIL1
• Synonyms: IKBL; NFKBIL
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001144961, the custom clone sequence may differ by one or more nucleotides
  ATGAGTAACCCCTCCCCCCAGGTTCCAGAGGAAGAAGCCTCCACATCTGTCTGCCGGCCC
  AAGAGTTCCATGGCCTCCACTTCCCGCCGCCAACGCCGAGAACGTCGCTTTCGTCGTTAC
  TTGTCTGCAGGACGGCTGGTCCGGGCCCAGGCCCTCCTCCAGCGACACCCAGGCCTCGAT
  GTAGATGCTGGGCAGCCCCCACCACTGCACCGGGCCTGTGCCCGCCACGATGCCCCTGCC
  CTGTGCCTGCTGCTTCGGCTCGGGGCTGACCCTGCCCACCAGGACCGCCATGGGGACACG
  GCACTGCATGCTGCTGCCCGCCAGGGCCCAGATGCCTACACCGATTTCTTCCTCCCGCTG
  CTAAGCCGCTGTCCCTCCGCCATGGGAATAAAGAATAAGGATGGGGAGACCCCTGGCCAA
  ATTTTGGGCTGGGGACCCCCCTGGGATTCTGCTGAAGAGGAGGAAGAAGATGATGCCTCC
  AAGGAGCGGGAATGGAGACAGAAGCTCCAGGGTGATGCCTCCCATGAAACCCAGGAACCT
  GAGTCCTTCTCAGCCTGGTCAGATCGCCTGGCCCGGGAACATGCCCAGAAGTGCCAGCAG
  CAGCAGCGAGAAGCAGAGGGATCCCGTCGACCCCCACGTGCTGAGGGCTCCAGCCAGAGC
  TGGCGACAGCAGGAGGAGGAGCAGCGGCTCTTCAGGGAGCGAGCCCGGGCCAAGGAGGAA
  GAGCTGCGTGAGAGCCGAGCCAGGAGGGCGCAGGAGGCTCTAGGGGACCGAGAACCCAAG
  CCAACCAGGGCCGGGCCCAGGGAAGAGCACCCCAGAGGAGCGGGGAGGGGCAGCCTCTGG
  CGATTTGGTGATGTGCCCTGGCCCTGCCCTGGGGGAGGGGACCCAGAGGCCATGGCTGCA
  GCCCTGGTGGCCAGGGGCCCCCCTTTGGAGGAACAGGGGGCTCTGAGGAGGTACTTGAGG
  GTCCAGCAGGTCCGCTGGCACCCTGACCGCTTCCTGCAGCGATTCCGAAGCCAGATTGAG
  ACCTGGGAGCTGGGCCGTGTGATGGGAGCAGTGACAGCCCTTTCTCAGGCCCTGAATCGC
  CATGCAGAGGCCCTCAAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001144961
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001144961.1, NP_001138433.1
• RefSeq Size: 1465 bp
• RefSeq ORF: 1101 bp
• Locus ID: 4795
• Cytogenetics: 6p21.33
• Protein Families: Transcription Factors
• Gene Summary: 'This gene encodes a divergent member of the I-kappa-B family of proteins. Its function has not been determined. The gene lies within the major histocompatibility complex (MHC) class I region on chromosome 6. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 3' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.