MUC7 (NM_001145007) Human Untagged Clone
CAT#: SC325020
MUC7 (untagged)-Human mucin 7, secreted (MUC7), transcript variant 2
"NM_001145007" in other vectors (2)
Product Images
Other products for "MUC7"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MUC7 |
Synonyms | MG2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145007, the custom clone sequence may differ by one or more nucleotides
ATGAAAACTCTGCCGCTGTTTGTGTGCATCTGTGCACTGAGTGCTTGCTTCTCGTTCAGT GAAGGTCGAGAAAGGGATCATGAACTACGTCACAGAAGGCATCATCACCAATCACCCAAA TCTCACTTTGAATTACCACATTATCCTGGACTGCTAGCTCACCAGAAGCCGTTCATTAGA AAGTCCTATAAATGTCTGCACAAACGCTGTAGGCCTAAGCTTCCACCTTCACCTAATAAC CCCCCCAAATTCCCAAATCCTCACCAGCCACCTAAACATCCAGATAAAAATAGCAGTGTG GTCAACCCTACCTTAGTGGCTACAACCCAAATTCCATCTGTGACTTTCCCATCAGCTTCC ACCAAAATTACTACCCTTCCAAATGTGACTTTTCTTCCCCAGAATGCCACCACCATATCT TCAAGAGAAAATGTTAACACAAGCTCTTCTGTAGCTACATTAGCACCAGTGAATTCCCCA GCTCCACAAGACACCACAGCTGCCCCACCCACACCTTCTGCAACTACACCAGCTCCACCA TCTTCCTCAGCTCCACCAGAGACCACAGCTGCCCCACCCACACCTTCTGCAACTACACAA GCTCCACCATCTTCCTCAGCTCCACCAGAGACCACAGCTGCCCCACCCACACCTCCTGCA ACTACACCAGCTCCACCATCTTCCTCAGCTCCACCAGAGACCACAGCTGCCCCACCCACA CCTTCTGCAACTACACCAGCTCCACTATCTTCCTCAGCTCCACCAGAGACCACAGCTGTC CCACCCACACCTTCTGCAACTACCCTAGACCCATCATCCGCCTCAGCTCCACCAGAGACC ACAGCTGCCCCACCCACACCTTCTGCAACTACACCAGCTCCACCGTCTTCCCCAGCTCCA CAAGAGACCACAGCTGCCCCAATTACCACACCTAATTCTTCCCCAACTACTCTTGCACCT GACACTTCTGAAACTTCAGCTGCACCCACACACCAGACTACTACTTCGGTCACTACTCAA ACTACTACTACTAAACAACCAACTTCAGCTCCTGGCCAAAATAAAATTTCTCGATTTCTT TTATATATGAAGAATCTACTAAACAGAATTATTGACGACATGGTGGAGCAA |
Restriction Sites | Please inquire |
ACCN | NM_001145007 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145007.1, NP_001138479.1 |
RefSeq Size | 2504 bp |
RefSeq ORF | 1134 bp |
Locus ID | 4589 |
Cytogenetics | 4q13.3 |
Protein Families | Secreted Protein |
Gene Summary | 'This gene encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each composed of 23 amino acids. This antimicrobial protein has antibacterial and antifungal activity. The most common allele contains 6 repeats, and some alleles may be associated with susceptibility to asthma. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Oct 2014]' Transcript Variant: This variant (2) contains an alternate 5' terminal non-coding exon, hence has a different 5' UTR compared to transcript variant 1. Transcript variants 1, 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.