RbAp48 (RBBP4) (NM_001135256) Human Untagged Clone

CAT#: SC325035

RBBP4 (untagged)-Human retinoblastoma binding protein 4 (RBBP4), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RBBP4
• Synonyms: lin-53; NURF55; RBAP48
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135256, the custom clone sequence may differ by one or more nucleotides
  ATGACCCATGCTCTGGAGTGGCCCAGCCTAACTGCCCAGTGGCTTCCAGATGTAACCAGA
  CCAGAAGGGAAAGATTTCAGCATTCATCGACTTGTCCTGGGGACACACACATCGGATGAA
  CAAAACCATCTTGTTATAGCCAGTGTGCAGCTCCCTAATGATGATGCTCAGTTTGATGCG
  TCACACTACGACAGTGAGAAAGGAGAATTTGGAGGTTTTGGTTCAGTTAGTGGAAAAATT
  GAAATAGAAATCAAGATCAACCATGAAGGAGAAGTAAACAGGGCCCGTTATATGCCCCAG
  AACCCTTGTATCATCGCAACAAAGACTCCTTCCAGTGATGTTCTTGTTTTTGACTATACA
  AAACATCCTTCTAAACCAGATCCTTCTGGAGAGTGCAACCCAGACTTGCGTCTCCGTGGA
  CATCAGAAGGAAGGCTATGGGCTTTCTTGGAACCCAAATCTCAGTGGGCACTTACTTAGT
  GCTTCAGATGACCATACCATCTGCCTGTGGGACATCAGTGCCGTTCCAAAGGAGGGAAAA
  GTGGTAGATGCGAAGACCATCTTTACAGGGCATACGGCAGTAGTAGAAGATGTTTCCTGG
  CATCTACTCCATGAGTCTCTGTTTGGGTCAGTTGCTGATGATCAGAAACTTATGATTTGG
  GATACTCGTTCAAACAATACTTCCAAACCAAGCCACTCAGTTGATGCTCACACTGCTGAA
  GTGAACTGCCTTTCTTTCAATCCTTATAGTGAGTTCATTCTTGCCACAGGATCAGCTGAC
  AAGACTGTTGCCTTGTGGGATCTGAGAAATCTGAAACTTAAGTTGCATTCCTTTGAGTCA
  CATAAGGATGAAATATTCCAGGTTCAGTGGTCACCTCACAATGAGACTATTTTAGCTTCC
  AGTGGTACTGATCGCAGACTGAATGTCTGGGATTTAAGTAAAATTGGAGAGGAACAATCC
  CCAGAAGATGCAGAAGACGGGCCACCAGAGTTGTTGTTTATTCATGGTGGTCATACTGCC
  AAGATATCTGATTTCTCCTGGAATCCCAATGAACCTTGGGTGATTTGTTCTGTATCAGAA
  GACAATATCATGCAAGTGTGGCAAATGGCAGAGAACATTTATAATGATGAAGACCCTGAA
  GGAAGCGTGGATCCAGAAGGACAAGGGTCC
  
• Restriction Sites: Please inquire
• ACCN: NM_001135256
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001135256.1, NP_001128728.1
• RefSeq Size: 7843 bp
• RefSeq ORF: 1173 bp
• Locus ID: 5928
• Cytogenetics: 1p35.1
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. It is present in protein complexes involved in histone acetylation and chromatin assembly. It is part of the Mi-2 complex which has been implicated in chromatin remodeling and transcriptional repression associated with histone deacetylation. This encoded protein is also part of co-repressor complexes, which is an integral component of transcriptional silencing. It is found among several cellular proteins that bind directly to retinoblastoma protein to regulate cell proliferation. This protein also seems to be involved in transcriptional repression of E2F-responsive genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]'
  Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.