TGF beta Receptor I (TGFBR1) (NM_001130916) Human Untagged Clone

CAT#: SC325085

TGFBR1 (untagged)-Human transforming growth factor, beta receptor 1 (TGFBR1), transcript variant 2


  "NM_001130916" in other vectors (6)

Reconstitution Protocol

USD 760.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "TGFBR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TGFBR1
Synonyms AAT5; ACVRLK4; ALK-5; ALK5; ESS1; LDS1; LDS1A; LDS2A; MSSE; SKR4; tbetaR-I; TBR-i; TBRI; TGFR-1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001130916, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCGGCGGTCGCTGCTCCGCGTCCCCGGCTGCTCCTCCTCGTGCTGGCGGCGGCG
GCGGCGGCGGCGGCGGCGCTGCTCCCGGGGGCGACGGCGTTACAGTGTTTCTGCCACCTC
TGTACAAAAGACAATTTTACTTGTGTGACAGATGGGCTCTGCTTTGTCTCTGTCACAGAG
ACCACAGACAAAGTTATACACAACAGCATGTGTATAGCTGAAATTGACTTAATTCCTCGA
GATAGGCCGTTTGTATGTGCACCCTCTTCAAAAACTGGGTCTGTGACTACAACATATTGC
TGCAATCAGGACCATTGCAATAAAATAGAACTTCCAACTACTGGTTTACCATTGCTTGTT
CAGAGAACAATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGA
GAAGTTTGGAGAGGAAAGTGGCGGGGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGA
GAAGAACGTTCGTGGTTCCGTGAGGCAGAGATTTATCAAACTGTAATGTTACGTCATGAA
AACATCCTGGGATTTATAGCAGCAGACAATAAAGACAATGGTACTTGGACTCAGCTCTGG
TTGGTGTCAGATTATCATGAGCATGGATCCCTTTTTGATTACTTAAACAGATACACAGTT
ACTGTGGAAGGAATGATAAAACTTGCTCTGTCCACGGCGAGCGGTCTTGCCCATCTTCAC
ATGGAGATTGTTGGTACCCAAGGAAAGCCAGCCATTGCTCATAGAGATTTGAAATCAAAG
AATATCTTGGTAAAGAAGAATGGAACTTGCTGTATTGCAGACTTAGGACTGGCAGTAAGA
CATGATTCAGCCACAGATACCATTGATATTGCTCCAAACCACAGAGTGGGAACAAAAAGG
TACATGGCCCCTGAAGTTCTCGATGATTCCATAAATATGAAACATTTTGAATCCTTCAAA
CGTGCTGACATCTATGCAATGGGCTTAGTATTCTGGGAAATTGCTCGACGATGTTCCATT
GGTGGAATTCATGAAGATTACCAACTGCCTTATTATGATCTTGTACCTTCTGACCCATCA
GTTGAAGAAATGAGAAAAGTTGTTTGTGAACAGAAGTTAAGGCCAAATATCCCAAACAGA
TGGCAGAGCTGTGAAGCCTTGAGAGTAATGGCTAAAATTATGAGAGAATGTTGGTATGCC
AATGGAGCAGCTAGGCTTACAGCATTGCGGATTAAGAAAACATTATCGCAACTCAGTCAA
CAGGAAGGCATCAAAATG
Restriction Sites Please inquire     
ACCN NM_001130916
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130916.1, NP_001124388.1
RefSeq Size 6244 bp
RefSeq ORF 1281 bp
Locus ID 7046
Cytogenetics 9q22.33
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Adherens junction, Chronic myeloid leukemia, Colorectal cancer, Cytokine-cytokine receptor interaction, Endocytosis, MAPK signaling pathway, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway
Gene Summary 'The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]'
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 3. The encoded isoform (2) is shorter than isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.