WEE1 (NM_001143976) Human Untagged Clone

CAT#: SC325087

WEE1 (untagged)-Human WEE1 homolog (S. pombe) (WEE1), transcript variant 2


  "NM_001143976" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "WEE1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WEE1
Synonyms WEE1A; WEE1hu
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001143976, the custom clone sequence may differ by one or more nucleotides
ATGGATACAGAAAAATCAGGAAAAAGGGAATTTGATGTGCGACAGACTCCTCAAGTGAAT
ATTAATCCTTTTACTCCGGATTCTTTGTTGCTTCATTCCTCAGGACAGTGTCGTCGTAGA
AAGAGAACGTATTGGAATGATTCCTGTGGTGAAGACATGGAAGCCAGTGATTATGAGCTT
GAAGATGAAACAAGACCTGCTAAGAGAATTACAATTACTGAAAGCAATATGAAGTCCCGG
TATACAACAGAATTTCATGAGCTAGAGAAAATCGGCTCTGGAGAATTTGGTTCTGTATTT
AAGTGTGTGAAGAGGCTGGATGGATGCATTTATGCCATTAAGCGATCAAAAAAGCCATTG
GCGGGCTCTGTTGATGAGCAGAACGCTTTGAGAGAAGTATATGCTCATGCAGTGCTTGGA
CAGCATTCTCATGTAGTTCGATATTTCTCTGCGTGGGCAGAAGATGATCATATGCTTATA
CAGAATGAATATTGTAATGGTGGAAGTTTAGCTGATGCTATAAGTGAAAACTACAGAATC
ATGAGTTACTTTAAAGAAGCAGAGTTGAAGGATCTCCTTTTGCAAGTTGGCCGAGGCTTG
AGGTATATTCATTCAATGTCTTTGGTTCACATGGATATAAAACCTAGTAATATTTTCATA
TCTCGAACCTCAATCCCAAATGCTGCCTCTGAAGAAGGAGACGAAGATGATTGGGCATCC
AACAAAGTTATGTTTAAAATAGGTGATCTTGGGCATGTAACAAGGATCTCCAGTCCACAA
GTTGAAGAGGGCGATAGTCGTTTTCTTGCAAATGAAGTTTTACAGGAGAATTATACCCAT
CTACCAAAAGCAGATATTTTTGCGCTTGCCCTCACAGTGGTATGTGCTGCTGGTGCTGAA
CCTCTTCCGAGAAATGGAGATCAATGGCATGAAATCAGACAGGGTAGATTACCTCGGATA
CCACAAGTGCTTTCCCAAGAATTTACAGAGTTGCTAAAAGTTATGATTCATCCAGATCCA
GAGAGAAGACCTTCAGCAATGGCACTGGTAAAGCATTCAGTATTGCTGTCCGCTTCTAGA
AAGAGTGCAGAACAATTACGAATAGAATTGAATGCCGAAAAGTTCAAAAATTCACTTTTA
CAAAAAGAACTCAAGAAAGCACAGATGGCAAAAGCTGCAGCTGAGGAAAGAGCACTCTTC
ACTGACCGGATGGCCACTAGGTCCACCACCCAGAGTAATAGAACATCTCGACTTATTGGA
AAGAAAATGAACCGCTCTGTCAGCCTTACTATATAC
Restriction Sites Please inquire     
ACCN NM_001143976
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001143976.1, NP_001137448.1
RefSeq Size 3234 bp
RefSeq ORF 1299 bp
Locus ID 7465
Cytogenetics 11p15.4
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Protein Pathways Cell cycle
Gene Summary 'This gene encodes a nuclear protein, which is a tyrosine kinase belonging to the Ser/Thr family of protein kinases. This protein catalyzes the inhibitory tyrosine phosphorylation of CDC2/cyclin B kinase, and appears to coordinate the transition between DNA replication and mitosis by protecting the nucleus from cytoplasmically activated CDC2 kinase. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) has a different first exon and 5' UTR, compared to variant 1. This difference causes translation initiation from an in-frame downstream AUG and an isoform (2) with a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.