ALDH3A1 (NM_001135167) Human Untagged Clone

CAT#: SC325097

ALDH3A1 (untagged)-Human aldehyde dehydrogenase 3 family, member A1 (ALDH3A1), transcript variant 3


  "NM_001135167" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ALDH3A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALDH3A1
Synonyms ALDH3; ALDHIII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001135167, the custom clone sequence may differ by one or more nucleotides


ATGAGCAAGATCAGCGAGGCCGTGAAGCGCGCCCGCGCCGCCTTCAGCTCGGGCAGGACCCGTCCGCTGC
AGTTCCGGATCCAGCAGCTGGAGGCGCTGCAGCGCCTGATCCAGGAGCAGGAGCAGGAGCTGGTGGGCGC
GCTGGCCGCAGACCTGCACAAGAATGAATGGAACGCCTACTATGAGGAGGTGGTGTACGTCCTAGAGGAG
ATCGAGTACATGATCCAGAAGCTCCCTGAGTGGGCCGCGGATGAGCCCGTGGAGAAGACGCCCCAGACTC
AGCAGGACGAGCTCTACATCCACTCGGAGCCACTGGGCGTGGTCCTCGTCATTGGCACCTGGAACTACCC
CTTCAACCTCACCATCCAGCCCATGGTGGGCGCCATCGCTGCAGGGAACTCAGTGGTCCTCAAGCCCTCG
GAGCTGAGTGAGAACATGGCGAGCCTGCTGGCTACCATCATCCCCCAGTACCTGGACAAGGATCTGTACC
CAGTAATCAATGGGGGTGTCCCTGAGACCACGGAGCTGCTCAAGGAGAGGTTCGACCATATCCTGTACAC
GGGCAGCACGGGGGTGGGGAAGATCATCATGACGGCTGCTGCCAAGCACCTGACCCCTGTCACGCTGGAG
CTGGGAGGGAAGAGTCCCTGCTACGTGGACAAGAACTGTGACCTGGACGTGGCCTGCCGACGCATCGCCT
GGGGGAAATTCATGAACAGTGGCCAGACCTGCGTGGCCCCTGACTACATCCTCTGTGACCCCTCGATCCA
GAACCAAATTGTGGAGAAGCTCAAGAAGTCACTGAAAGAGTTCTACGGGGAAGATGCTAAGAAATCCCGG
GACTATGGAAGAATCATTAGTGCCCGGCACTTCCAGAGGGTGATGGGCCTGATTGAGGGCCAGAAGGTGG
CTTATGGGGGCACCGGGGATGCCGCCACTCGCTACATAGCCCCCACCATCCTCACGGACGTGGACCCCCA
GTCCCCGGTGATGCAAGAGGAGATCTTCGGGCCTGTGCTGCCCATCGTGTGCGTGCGCAGCCTGGAGGAG
GCCATCCAGTTCATCAACCAGCGTGAGAAGCCCCTGGCCCTCTACATGTTCTCCAGCAACGACAAGGTGA
TTAAGAAGATGATTGCAGAGACATCCAGTGGTGGGGTGGCGGCCAACGATGTCATCGTCCACATCACCTT
GCACTCTCTGCCCTTCGGGGGCGTGGGGAACAGCGGCATGGGATCCTACCATGGCAAGAAGAGCTTCGAG
ACTTTCTCTCACCGCCGCTCTTGCCTGGTGAGGCCTCTGATGAATGATGAAGGCCTGAAGGTCAGATACC
CCCCGAGCCCGGCCAAGATGACCCAGCACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001135167
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135167.1, NP_001128639.1
RefSeq Size 1789 bp
RefSeq ORF 1362 bp
Locus ID 218
Cytogenetics 17p11.2
Protein Families Druggable Genome
Protein Pathways Drug metabolism - cytochrome P450, Glycolysis / Gluconeogenesis, Histidine metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary 'Aldehyde dehydrogenases oxidize various aldehydes to the corresponding acids. They are involved in the detoxification of alcohol-derived acetaldehyde and in the metabolism of corticosteroids, biogenic amines, neurotransmitters, and lipid peroxidation. The enzyme encoded by this gene forms a cytoplasmic homodimer that preferentially oxidizes aromatic and medium-chain (6 carbons or more) saturated and unsaturated aldehyde substrates. It is thought to promote resistance to UV and 4-hydroxy-2-nonenal-induced oxidative damage in the cornea. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]'
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-3 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.