Epoxide hydrolase (EPHX1) (NM_001136018) Human Untagged Clone

CAT#: SC325103

EPHX1 (untagged)-Human epoxide hydrolase 1, microsomal (xenobiotic) (EPHX1), transcript variant 2


  "NM_001136018" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "EPHX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EPHX1
Synonyms EPHX; EPOX; HYL1; MEH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001136018, the custom clone sequence may differ by one or more nucleotides


ATGTGGCTAGAAATCCTCCTCACTTCAGTGCTGGGCTTTGCCATCTACTGGTTCATCTCCCGGGACAAAG
AGGAAACTTTGCCACTTGAAGATGGGTGGTGGGGGCCAGGCACGAGGTCCGCAGCCAGGGAGGACGACAG
CATCCGCCCTTTCAAGGTGGAAACGTCAGATGAGGAGATCCACGACTTACACCAGAGGATCGATAAGTTC
CGTTTCACCCCACCTTTGGAGGACAGCTGCTTCCACTATGGCTTCAACTCCAACTACCTGAAGAAAGTCA
TCTCCTACTGGCGGAATGAATTTGACTGGAAGAAGCAGGTGGAGATTCTCAACAGATACCCTCACTTCAA
GACTAAGATTGAAGGGCTGGACATCCACTTCATCCACGTGAAGCCCCCCCAGCTGCCCGCAGGCCATACC
CCGAAGCCCTTGCTGATGGTGCACGGCTGGCCCGGCTCTTTCTACGAGTTTTATAAGATCATCCCACTCC
TGACTGACCCCAAGAACCATGGCCTGAGCGATGAGCACGTTTTTGAAGTCATCTGCCCTTCCATCCCTGG
CTATGGCTTCTCAGAGGCATCCTCCAAGAAGGGGTTCAACTCGGTGGCCACCGCCAGGATCTTTTACAAG
CTGATGCTGCGGCTGGGCTTCCAGGAATTCTACATTCAAGGAGGGGACTGGGGGTCCCTGATCTGCACTA
ATATGGCCCAGCTGGTGCCCAGCCACGTGAAAGGCCTGCACTTGAACATGGCTTTGGTTTTAAGCAACTT
CTCTACCCTGACCCTCCTCCTGGGACAGCGTTTCGGGAGGTTTCTTGGCCTCACTGAGAGGGATGTGGAG
CTGCTGTACCCCGTCAAGGAGAAGGTATTCTACAGCCTGATGAGGGAGAGCGGCTACATGCACATCCAGT
GCACCAAGCCTGACACCGTAGGCTCTGCTCTGAATGACTCTCCTGTGGGTCTGGCTGCCTATATTCTAGA
GAAGTTTTCCACCTGGACCAATACGGAATTCCGATACCTGGAGGATGGAGGCCTGGAAAGGAAGTTCTCC
CTGGACGACCTGCTGACCAACGTCATGCTCTACTGGACAACAGGCACCATCATCTCCTCCCAGCGCTTCT
ACAAGGAGAACCTGGGACAGGGCTGGATGACCCAGAAGCATGAGCGGATGAAGGTCTATGTGCCCACTGG
CTTCTCTGCCTTCCCTTTTGAGCTATTGCACACGCCTGAAAAGTGGGTGAGGTTCAAGTACCCAAAGCTC
ATCTCCTATTCCTACATGGTTCGTGGGGGCCACTTTGCGGCCTTTGAGGAGCCGGAGCTGCTCGCCCAGG
ACATCCGCAAGTTCCTGTCGGTGCTGGAGCGGCAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001136018
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136018.3, NP_001129490.1
RefSeq Size 1699 bp
RefSeq ORF 1368 bp
Locus ID 2052
Cytogenetics 1q42.12
Protein Families Druggable Genome, Protease
Protein Pathways Metabolism of xenobiotics by cytochrome P450
Gene Summary 'Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]'
Transcript Variant: This variant (2) has an alternate upstream 5' UTR exon, as compared to variant 1. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.