Presenilin 1 (PSEN1) (NM_007318) Human Untagged Clone

CAT#: SC325119

PSEN1 (untagged)-Human presenilin 1 (PSEN1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSEN1
• Synonyms: ACNINV3; AD3; FAD; PS-1; PS1; S182
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_007318, the custom clone sequence may differ by one or more nucleotides
  ATGACAGAGTTACCTGCACCGTTGTCCTACTTCCAGAATGCACAGATGTCTGAGGACAAC
  CACCTGAGCAATACTAATGACAATAGAGAACGGCAGGAGCACAACGACAGACGGAGCCTT
  GGCCACCCTGAGCCATTATCTAATGGACGACCCCAGGGTAACTCCCGGCAGGTGGTGGAG
  CAAGATGAGGAAGAAGATGAGGAGCTGACATTGAAATATGGCGCCAAGCATGTGATCATG
  CTCTTTGTCCCTGTGACTCTCTGCATGGTGGTGGTCGTGGCTACCATTAAGTCAGTCAGC
  TTTTATACCCGGAAGGATGGGCAGCTAATCTATACCCCATTCACAGAAGATACCGAGACT
  GTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATCAGTGTCATTGTT
  GTCATGACTATCCTCCTGGTGGTTCTGTATAAATACAGGTGCTATAAGGTCATCCATGCC
  TGGCTTATTATATCATCTCTATTGTTGCTGTTCTTTTTTTCATTCATTTACTTGGGGGAA
  GTGTTTAAAACCTATAACGTTGCTGTGGACTACATTACTGTTGCACTCCTGATCTGGAAT
  TTTGGTGTGGTGGGAATGATTTCCATTCACTGGAAAGGTCCACTTCGACTCCAGCAGGCA
  TATCTCATTATGATTAGTGCCCTCATGGCCCTGGTGTTTATCAAGTACCTCCCTGAATGG
  ACTGCGTGGCTCATCTTGGCTGTGATTTCAGTATATGATTTAGTGGCTGTTTTGTGTCCG
  AAAGGTCCACTTCGTATGCTGGTTGAAACAGCTCAGGAGAGAAATGAAACGCTTTTTCCA
  GCTCTCATTTACTCCTCAACAATGGTGTGGTTGGTGAATATGGCAGAAGGAGACCCGGAA
  GCTCAAAGGAGAGTATCCAAAAATTCCAAGTATAATGCAGAAAGCACAGAAAGGGAGTCA
  CAAGACACTGTTGCAGAGAATGATGATGGCGGGTTCAGTGAGGAATGGGAAGCCCAGAGG
  GACAGTCATCTAGGGCCTCATCGCTCTACACCTGAGTCACGAGCTGCTGTCCAGGAACTT
  TCCAGCAGTATCCTCGCTGGTGAAGACCCAGAGGAAAGGGGAGTAAAACTTGGATTGGGA
  GATTTCATTTTCTACAGTGTTCTGGTTGGTAAAGCCTCAGCAACAGCCAGTGGAGACTGG
  AACACAACCATAGCCTGTTTCGTAGCCATATTAATTGGTTTGTGCCTTACATTATTACTC
  CTTGCCATTTTCAAGAAAGCATTGCCAGCTCTTCCAATCTCCATCACCTTTGGGCTTGTT
  TTCTACTTTGCCACAGATTATCTTGTACAGCCTTTTATGGACCAATTAGCATTCCATCAA
  TTTTATATC
  
• Restriction Sites: Please inquire
• ACCN: NM_007318
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_007318.2, NP_015557.2
• RefSeq Size: 6095 bp
• RefSeq ORF: 1392 bp
• Locus ID: 5663
• Cytogenetics: 14q24.2
• Domains: Presenilin, PSN
• Protein Families: Druggable Genome, Protease, Transmembrane
• Protein Pathways: Alzheimer's disease, Neurotrophin signaling pathway, Notch signaling pathway, Wnt signaling pathway
• Gene Summary: 'Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1; PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008]'
  Transcript Variant: This variant (2) uses an alternative donor splice site at one of the coding exons compared to transcript variant 1. It maintains the same reading frame, and encodes a shorter isoform (I-463) missing a 4 aa peptide compared to isoform I-467.