TBL1 (TBL1X) (NM_001139468) Human Untagged Clone
CAT#: SC325165
TBL1X (untagged)-Human transducin (beta)-like 1X-linked (TBL1X), transcript variant 4
"NM_001139468" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TBL1X |
Synonyms | EBI; SMAP55; TBL1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001139468, the custom clone sequence may differ by one or more nucleotides
ATGAGCATAACCAGTGACGAGGTGAACTTTCTGGTGTATCGGTATCTCCAGGAGTCAGGT TTTTCCCACTCGGCTTTCACGTTTGGGATTGAGAGCCACATCAGCCAGTCCAACATCAAT GGGACGCTAGTGCCACCGGCCGCCCTCATCTCCATTCTCCAGAAGGGCCTGCAGTATGTA GAGGCCGAGATCAGTATCAACGAGGATGGCACAGTGTTCGACGGCCGCCCCATAGAGTCC CTGTCACTGATAGACGCCGTGATGCCCGACGTGGTGCAGACGCGGCAGCAGGCATTCCGA GAGAAGCTCGCTCAGCAGCAAGCCAGTGCGGCGGCGGCGGCGGCTGCGGCCACGGCAGCA GCGACAGCAGCCACCACGACCTCAGCCGGCGTTTCCCACCAAAATCCATCGAAGAACAGA GAGGCCACGGTGAATGGGGAAGAGAACAGAGCACATTCAGTCAATAATCACGCGAAGCCA ATGGAAATAGATGGAGAGGTTGAGATTCCATCCAGCAAAGCCACAGTCCTTCGGGGCCAT GAGTCTGAGGTGTTCATTTGTGCCTGGAATCCTGTCAGTGATTTGCTAGCCTCCGGATCT GGAGACTCAACTGCAAGGATATGGAACCTGAATGAGAATAGCAACGGGGGCTCCACCCAG CTCGTGTTGAGGCACTGTATACGAGAGGGGGGCCATGACGTCCCGAGTAACAAAGACGTC ACCTCACTGGACTGGAATACCAATGGAACACTCTTGGCTACGGGTTCATATGACGGTTTT GCAAGAATATGGACGGAAGATGGTAACCTGGCCAGCACCTTAGGCCAACATAAAGGCCCC ATCTTTGCCTTGAAATGGAACCGAAAGGGGAATTACATTTTGAGTGCTGGTGTAGACAAA ACAACAATAATTTGGGATGCCCACACAGGAGAAGCCAAACAGCAGTTTCCTTTTCATTCA GCCCCTGCCCTTGATGTGGACTGGCAGAACAACACGACCTTTGCCTCCTGTAGCACAGAC ATGTGTATCCATGTGTGCAGGCTCGGCTGTGACCGCCCAGTCAAAACCTTCCAGGGACAC ACAAACGAGGTCAACGCCATCAAATGGGATCCGTCTGGAATGTTGCTGGCATCCTGCTCG GATGACATGACATTGAAGATCTGGAGCATGAAACAGGAGGTGTGCATCCATGATCTTCAG GCTCACAATAAAGAGATCTACACCATCAAGTGGAGCCCCACTGGGCCCGCCACCAGCAAC CCAAACTCCAACATCATGTTGGCAAGTGCTTCGTTTGATTCTACGGTGCGACTGTGGGAC ATAGAACGAGGCGTCTGCACCCACACGCTCACGAAGCATCAGGAGCCTGTCTATAGCGTA GCTTTCAGCCCTGATGGGAAGTACTTGGCCAGTGGATCCTTCGACAAGTGCGTCCATATC TGGAATACTCAGAGTGGAAATCTTGTCCACAGCTACCGAGGCACTGGCGGCATCTTCGAG GTGTGCTGGAACGCCCGAGGAGACAAAGTGGGTGCCAGCGCGTCCGACGGCTCTGTGTGT GTTTTGGATCTGCGGAAG |
Restriction Sites | Please inquire |
ACCN | NM_001139468 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001139468.1, NP_001132940.1 |
RefSeq Size | 5586 bp |
RefSeq ORF | 1581 bp |
Locus ID | 6907 |
Cytogenetics | Xp22.31-p22.2 |
Protein Families | Transcription Factors |
Protein Pathways | Wnt signaling pathway |
Gene Summary | 'The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This encoded protein is found as a subunit in corepressor SMRT (silencing mediator for retinoid and thyroid receptors) complex along with histone deacetylase 3 protein. This gene is located adjacent to the ocular albinism gene and it is thought to be involved in the pathogenesis of the ocular albinism with late-onset sensorineural deafness phenotype. Four transcript variants encoding two different isoforms have been found for this gene. This gene is highly similar to the Y chromosome TBL1Y gene. [provided by RefSeq, Nov 2008]' Transcript Variant: This variant (4) differs in the 5' UTR and lacks the alternate first coding exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 3 and 4 both encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226934 | TBL1X (Myc-DDK-tagged)-Human transducin (beta)-like 1X-linked (TBL1X), transcript variant 4 |
USD 420.00 |
|
RG226934 | TBL1X (GFP-tagged) - Human transducin (beta)-like 1X-linked (TBL1X), transcript variant 4 |
USD 460.00 |
|
RC226934L3 | Lenti-ORF clone of TBL1X (Myc-DDK-tagged)-Human transducin (beta)-like 1X-linked (TBL1X), transcript variant 4 |
USD 620.00 |
|
RC226934L4 | Lenti-ORF clone of TBL1X (mGFP-tagged)-Human transducin (beta)-like 1X-linked (TBL1X), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review