TBL1 (TBL1X) (NM_001139468) Human Untagged Clone

CAT#: SC325165

TBL1X (untagged)-Human transducin (beta)-like 1X-linked (TBL1X), transcript variant 4


  "NM_001139468" in other vectors (4)

Reconstitution Protocol

USD 760.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TBL1X"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TBL1X
Synonyms EBI; SMAP55; TBL1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001139468, the custom clone sequence may differ by one or more nucleotides
ATGAGCATAACCAGTGACGAGGTGAACTTTCTGGTGTATCGGTATCTCCAGGAGTCAGGT
TTTTCCCACTCGGCTTTCACGTTTGGGATTGAGAGCCACATCAGCCAGTCCAACATCAAT
GGGACGCTAGTGCCACCGGCCGCCCTCATCTCCATTCTCCAGAAGGGCCTGCAGTATGTA
GAGGCCGAGATCAGTATCAACGAGGATGGCACAGTGTTCGACGGCCGCCCCATAGAGTCC
CTGTCACTGATAGACGCCGTGATGCCCGACGTGGTGCAGACGCGGCAGCAGGCATTCCGA
GAGAAGCTCGCTCAGCAGCAAGCCAGTGCGGCGGCGGCGGCGGCTGCGGCCACGGCAGCA
GCGACAGCAGCCACCACGACCTCAGCCGGCGTTTCCCACCAAAATCCATCGAAGAACAGA
GAGGCCACGGTGAATGGGGAAGAGAACAGAGCACATTCAGTCAATAATCACGCGAAGCCA
ATGGAAATAGATGGAGAGGTTGAGATTCCATCCAGCAAAGCCACAGTCCTTCGGGGCCAT
GAGTCTGAGGTGTTCATTTGTGCCTGGAATCCTGTCAGTGATTTGCTAGCCTCCGGATCT
GGAGACTCAACTGCAAGGATATGGAACCTGAATGAGAATAGCAACGGGGGCTCCACCCAG
CTCGTGTTGAGGCACTGTATACGAGAGGGGGGCCATGACGTCCCGAGTAACAAAGACGTC
ACCTCACTGGACTGGAATACCAATGGAACACTCTTGGCTACGGGTTCATATGACGGTTTT
GCAAGAATATGGACGGAAGATGGTAACCTGGCCAGCACCTTAGGCCAACATAAAGGCCCC
ATCTTTGCCTTGAAATGGAACCGAAAGGGGAATTACATTTTGAGTGCTGGTGTAGACAAA
ACAACAATAATTTGGGATGCCCACACAGGAGAAGCCAAACAGCAGTTTCCTTTTCATTCA
GCCCCTGCCCTTGATGTGGACTGGCAGAACAACACGACCTTTGCCTCCTGTAGCACAGAC
ATGTGTATCCATGTGTGCAGGCTCGGCTGTGACCGCCCAGTCAAAACCTTCCAGGGACAC
ACAAACGAGGTCAACGCCATCAAATGGGATCCGTCTGGAATGTTGCTGGCATCCTGCTCG
GATGACATGACATTGAAGATCTGGAGCATGAAACAGGAGGTGTGCATCCATGATCTTCAG
GCTCACAATAAAGAGATCTACACCATCAAGTGGAGCCCCACTGGGCCCGCCACCAGCAAC
CCAAACTCCAACATCATGTTGGCAAGTGCTTCGTTTGATTCTACGGTGCGACTGTGGGAC
ATAGAACGAGGCGTCTGCACCCACACGCTCACGAAGCATCAGGAGCCTGTCTATAGCGTA
GCTTTCAGCCCTGATGGGAAGTACTTGGCCAGTGGATCCTTCGACAAGTGCGTCCATATC
TGGAATACTCAGAGTGGAAATCTTGTCCACAGCTACCGAGGCACTGGCGGCATCTTCGAG
GTGTGCTGGAACGCCCGAGGAGACAAAGTGGGTGCCAGCGCGTCCGACGGCTCTGTGTGT
GTTTTGGATCTGCGGAAG
Restriction Sites Please inquire     
ACCN NM_001139468
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001139468.1, NP_001132940.1
RefSeq Size 5586 bp
RefSeq ORF 1581 bp
Locus ID 6907
Cytogenetics Xp22.31-p22.2
Protein Families Transcription Factors
Protein Pathways Wnt signaling pathway
Gene Summary 'The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This encoded protein is found as a subunit in corepressor SMRT (silencing mediator for retinoid and thyroid receptors) complex along with histone deacetylase 3 protein. This gene is located adjacent to the ocular albinism gene and it is thought to be involved in the pathogenesis of the ocular albinism with late-onset sensorineural deafness phenotype. Four transcript variants encoding two different isoforms have been found for this gene. This gene is highly similar to the Y chromosome TBL1Y gene. [provided by RefSeq, Nov 2008]'
Transcript Variant: This variant (4) differs in the 5' UTR and lacks the alternate first coding exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 3 and 4 both encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.