SPOCK2 (NM_001134434) Human Untagged Clone

CAT#: SC325437

SPOCK2 (untagged)-Human sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 (SPOCK2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPOCK2
• Synonyms: testican-2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001134434, the custom clone sequence may differ by one or more nucleotides
  ATGCGCGCCCCGGGCTGCGGGCGGCTGGTGCTGCCGCTGCTGCTCCTGGCCGCGGCAGCC
  CTGGCCGAAGGCGACGCCAAGGGGCTCAAGGAGGGCGAGACCCCCGGCAATTTCATGGAG
  GACGAGCAATGGCTGTCGTCCATCTCGCAGTACAGCGGCAAGATCAAGCACTGGAACCGC
  TTCCGAGACGTTCCCTCGTCCGACCCACCCAGTACAACGCAGGCCACACCA
  
• Restriction Sites: Please inquire
• ACCN: NM_001134434
• ORF Size: 234 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001134434.1, NP_001127906.1
• RefSeq Size: 1284
• RefSeq ORF: 234
• Locus ID: 9806
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a protein which binds with glycosaminoglycans to form part of the extracellular matrix. The protein contains thyroglobulin type-1, follistatin-like, and calcium-binding domains, and has glycosaminoglycan attachment sites in the acidic C-terminal region. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (1) shares only the two most-5' exons with variant 2 and has a distinct exon at its 3' end. This results in a protein (isoform 1) with a severely truncated C-terminus that lacks a SPARC_EC domain when compared to isoform 2.