FAM25G (NM_001137549) Human Untagged Clone

CAT#: SC325444

FAM25G (untagged)-Human family with sequence similarity 25, member G (FAM25G)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FAM25G
• Synonyms: bA301J7.4; FAM25A; FAM25B; FAM25C
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001137549, the custom clone sequence may differ by one or more nucleotides
  ATGCTGGGAGGCCTGGGGAAGCTGGCTGCCGAGGGCCTGGCCCACCGCACCGAGAAGGCC
  ACCGAGGGAGCCATTCATGCCGTGGAGGAAGTGGTGAAGGAGGTGGTGGGACATGCCAAG
  GAGACTGGAGAGAAAGCCATTGCTGAAGCCATAAAGAAAGCCCAGGAGTCAGGGGACAAA
  AAGATGAAGGAAATCACCGAGACAGTGACCAACACAGTCACAAATGCCATCACCCATGCA
  GCAGAAAGTCTGGACAAACTTGGACAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001137549
• ORF Size: 270 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001137549.1, NP_001131021.1
• RefSeq Size: 335
• RefSeq ORF: 270
• Locus ID: 100133093