PLAC8 (NM_001130716) Human Untagged Clone

CAT#: SC325476

PLAC8 (untagged)-Human placenta-specific 8 (PLAC8), transcript variant 1


  "NM_001130716" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLAC8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLAC8
Synonyms C15; DGIC; onzin; PNAS-144
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001130716, the custom clone sequence may differ by one or more nucleotides


ATGCAAGCTCAGGCGCCGGTGGTCGTTGTGACCCAACCTGGAGTCGGTCCCGGTCCGGCCCCCCAGAACT
CCAACTGGCAGACAGGCATGTGTGACTGTTTCAGCGACTGCGGAGTCTGTCTCTGTGGCACATTTTGTTT
CCCGTGCCTTGGGTGTCAAGTTGCAGCTGATATGAATGAATGCTGTCTGTGTGGAACAAGCGTCGCAATG
AGGACTCTCTACAGGACCCGATATGGCATCCCTGGATCTATTTGTGATGACTATATGGCAACTCTTTGCT
GTCCTCATTGTACTCTTTGCCAAATCAAGAGAGATATCAACAGAAGGAGAGCCATGCGTACTTTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001130716
ORF Size 348 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001130716.1, NP_001124188.1
RefSeq Size 1442
RefSeq ORF 348
Locus ID 51316
Gene Summary Belongs to the cornifelin family. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. Sequence Note: This RefSeq transcript was derived from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.