PCOTH (NM_001135816) Human Untagged Clone

CAT#: SC325477

C1QTNF9B (untagged)-Human prostate collagen triple helix (PCOTH), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PCOTH
• Synonyms: C1QTNF9B-AS1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135816, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCCAGAGGCCTGGTCCTCAGAGCTCACGATCTTATCAAATTTAATGGGCACATCTGAAGAAGGAA
  ACTTGCTCAGCACCGTGAGCCCCACAGTGAAAGCACTTTTTGGCAAGACTAGAGTCTCACCGATTTTCCC
  TTTCTCTCCTCGATCTCCTTTCCAGCCTCTTATTCCCCGGACTCCTGGCTCACCCTGGGGCCCCGTGGGT
  CCAGCTTCTCCCTTGGGACCAGGCTTTCCAATAGGGCCCATGGGGCCCGGTAAACCAGTTGGGCCCAAAG
  GCCCAATGTTGCCCCTTGGCCCCTCAGGACCAGTGGGACCCACGTCACCCTTATTCCCCTTCTGCCCCTG
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135816
• ORF Size: 351 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135816.1, NP_001129288.1
• RefSeq Size: 701
• RefSeq ORF: 351
• Locus ID: 542767
• Gene Summary: May be involved in growth and survival of prostate cancer cells through the TAF-Ibeta pathway. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2), also known as PCOTH-b, uses an alternate splice donor site at the end of exon 3 which puts an alternate translation initiation start site in frame. The resulting predicted protein (isoform 2) has a distinct N-terminus