PHPT1 (NM_001135861) Human Untagged Clone

CAT#: SC325483

PHPT1 (untagged)-Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PHPT1
• Synonyms: CGI-202; HEL-S-132P; HSPC141; PHP; PHP14
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135861, the custom clone sequence may differ by one or more nucleotides
  ATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGACATCGACTCCGACGGCGTCTTC
  AAGTATGTGCTGATCCGAGTCCACTCGGCTCCCCGCTCCGGGGCTCCGGCTGCAGAGAGC
  AAGGAGATCGTGCGCGGCTACAAGTGGGCTGAGTACCATGCGGACATCTACGACAAAGTG
  TCGGGCGACATGCAGAAGCAAGGCTGCGACTGTGAGTGTCTGGGCGGCGGGCGCATCTCC
  CACCAGAGTCAGGACAAGAAGATTCACGTGTACGGCTATTCCATGATGAGACCCACGTGC
  GTCCCTCTGGGCGCCTCAGGCCCCAGGATCCACCATCAAGGCCTATGGTCCTGCCCAGCA
  CGCCATTTCAAC
  
• Restriction Sites: Please inquire
• ACCN: NM_001135861
• ORF Size: 375 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135861.1, NP_001129333.1
• RefSeq Size: 1273
• RefSeq ORF: 375
• Locus ID: 29085
• Protein Families: Druggable Genome
• Protein Pathways: Fructose and mannose metabolism, Metabolic pathways, Riboflavin metabolism, Thiamine metabolism
• Gene Summary: This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta and ATP citrate lyase and in negatively regulating CD4 T lymphocytes by dephosphorylation and inhibition of KCa3.1 channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region and includes an alternate exon in the 3' coding region, compared to variant 4. This results in a frameshift and an early stop codon. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 4.