SNX3 (NM_152827) Human Untagged Clone

CAT#: SC325493

SNX3 (untagged)-Human sorting nexin 3 (SNX3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SNX3
• Synonyms: Grd19; MCOPS8; SDP3
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_152827 edited
  ATGGCGGAGACCGTGGCTGACACCCGGCGGCTGATCACCAAGCCGCAGAACCTGAATGAC
  GCCTACGGACCCCCCAGCAACTTCCTCGAGATCGATGTGAGCAACCCGCAAACGGTGGGG
  GTCGGCCGGGGCCGCTTCACCACTTACGAAATCAGGGTCAAGGTCGTAGTTCCCCCGCTC
  CCTGGGAAAGCGTTTTTGCGTCAGCTTCCTTTTAGAGGAGATGATGGAATATTTGATGAC
  AATTTTATTGAGGAAAGAAAACAAGGGCTGGAGCAGTTTATAAACAAGGTCGCTGGTCAT
  CCTCTGGCACAGAACGAACGTTGTCTTCACATGTTTTTACAAGATGAAATAATAGATAAA
  AGCTATACTCCATCTAAAATAAGACATGCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_152827
• ORF Size: 393 bp
• Insert Size: 750
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_152827.2, NP_690040.1
• RefSeq Size: 1401
• RefSeq ORF: 393
• Locus ID: 8724
• Gene Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like most family members. This protein interacts with phosphatidylinositol-3-phosphate, and is involved in protein trafficking. A pseudogene of this gene is present on the sex chromosomes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) lacks an in-frame coding exon, compared to variant 1. It encodes isoform b, also known as SNX3A, which is shorter than isoform a.