EFCAB2 (NM_001143943) Human Untagged Clone

CAT#: SC325497

EFCAB2 (untagged)-Human EF-hand calcium binding domain 2 (EFCAB2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EFCAB2
• Synonyms: CFAP200; DRC8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001143943, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGACGAGAAGGACAGGGAAGAGATAATAGTAGCAGAATTTCACAAAAAAATCAAAGAGGCATTTG
  AAGTCTTTGACCATGAGTCGAATAATACAGTGGATGTGAGAGAGATTGGAACAATTATCAGGTCATTAGG
  ATGCTGTCCTACGGAAGGAGAGCTGCATGATCTGATTGCAGAGGTAGAGGAAGAAGAACCCACTGGATAC
  ATTCGATTCGAAAAATTTCTTCCGGTGATGACAGAAATACTACTAGAAAGAAAATACAGACCAATTCCAG
  AAGATGTCCTTCTTCGAGCTTTTGAGGTTTTAGATTCAGCTAAACGTGGGTTTCTTACTAAGGACGAGCT
  GATCAAGTATATGACTGAAGAAGATGGAGTTTCGCTCCGTCGCCCAGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001143943
• ORF Size: 402 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001143943.1, NP_001137415.1
• RefSeq Size: 3772
• RefSeq ORF: 402
• Locus ID: 84288
• Gene Summary: The gene encodes a protein that contains two EF-hand calcium-binding domains although its function has yet to be determined. Alternatively spliced transcripts have been observed. [provided by RefSeq, Mar 2014]
  Transcript Variant: This variant (2) represents the longest transcript and encodes the shortest protein (isoform b).