ESM1 (NM_001135604) Human Untagged Clone

CAT#: SC325499

ESM1 (untagged)-Human endothelial cell-specific molecule 1 (ESM1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ESM1
• Synonyms: endocan
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135604, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGAGCGTCTTGCTGCTGACCACGCTCCTCGTGCCTGCACACCTGGTGGCCGCCTGGAGCAATAATT
  ATGCGGTGGACTGCCCTCAACACTGTGACAGCAGTGAGTGCAAAAGCAGCCCGCGCTGCAAGAGGACAGT
  GCTCGACGACTGTGGCTGCTGCCGAGTGTGCGCTGCAGGGCGGGGAGAAACTTGCTACCGCACAGTCTCA
  GGCATGGATGGCATGAAGTGTGGCCCGGGGCTGAGGTGTCAGCCTTCTAATGGGGAGGATCCTTTTGGTG
  AAGAGTTTGGTATCTGCAAAGAGCATGACATGGCATCTGGAGATGGCAATATTGTGAGAGAAGAAGTTGT
  GAAAGAGAATGCTGCCGGGTCTCCCGTAATGAGGAAATGGTTAAATCCACGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135604
• ORF Size: 405 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135604.1, NP_001129076.1
• RefSeq Size: 1939
• RefSeq ORF: 405
• Locus ID: 11082
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.