CCDC169 (NM_001144983) Human Untagged Clone

CAT#: SC325509

CCDC169 (untagged)-Human chromosome 13 open reading frame 38 (C13orf38), transcript variant 3


  "NM_001144983" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCDC169"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCDC169
Synonyms C13orf38
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001144983, the custom clone sequence may differ by one or more nucleotides
ATGCCAGTGGAATCCTTAAACACATTACTTAAACAGCTAGAAGAAGAAAAGAAGACTCTT
GAAAGTCAAGTGAAATACTATGCACTTAAACTGGAACAAGAATCAAAGGCTTACCAGAAG
ATCAACAATGAACGCCGTACATACCTAGCTGAAATGTCTCAGGGTTCTGGTTTACATCAA
GTTTCTAAAAGGCAACAGGTGGATCAACTGCCTAGGATGCAAGAGAATCTAGTGAAAACC
CTCCTCTTAAAAGAAGAATTGGACCCTTTAAAGGTCAGCTGCTTGGAGACATTGGGTTTC
AGTGCTGCAGGTGTGGCTGGACCAGAGAATAGGACATGCCTCGGACAAAAAGCACTCTGG
CCCGCCTGCTTACATGGGTCCTCAACCTTGGCTGTGTGTCAGACTCACCTGAAGAGC
Restriction Sites Please inquire     
ACCN NM_001144983
ORF Size 420 bp
Insert Size 937
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001144983.1, NP_001138455.1
RefSeq Size 937
RefSeq ORF 420
Locus ID 728591

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.