EEF1E1 (NM_001135650) Human Untagged Clone

CAT#: SC325510

EEF1E1 (untagged)-Human eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EEF1E1
• Synonyms: AIMP3; P18
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135650, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCGGCCGCAGAGTTGTCGCTACTGGAGAAGTCCCTGGGACTGAGTAAGGGGAATAAATACAGTG
  CTCAGGGCGAGCGACAGATTCCAGTTCTTCAGACAAACAATGGTCCAAGTCTAACAGGATTGACTACTAT
  AGCAGCTCATCTAGTCAAGCAAGCCAACAAAGAATATTTGCTGGGGAGTACTGCAGAAGAAAAAGCAATC
  GTTCAGCAGTGGTTAGAATACAGGGTCACTCAAGTAGATGGGCACTCCAGTAAAAATGACATCCACACAC
  TGTTGAAGGATCTTAATTCATATCTTGAAGATAAAGTCTACCTTACAGGGTATAACTTTACATTAGCAGA
  TATACTATTGTACTATGGACTTCATCGCTTTATAATAAGGAAGCTGAGGCACACAGAGGTAGGGAACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135650
• ORF Size: 420 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135650.1, NP_001129122.1
• RefSeq Size: 609
• RefSeq ORF: 420
• Locus ID: 9521
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, the encoded protein is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. However, its mouse homolog has been shown to translocate to the nucleus in response to DNA damage, and it plays a positive role in ATM/ATR-mediated p53 activation. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream MUTED (muted homolog) gene. An EEF1E1-related pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (2) includes an alternate 3' terminal exon, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1.