DAZAP2 (NM_001136264) Human Untagged Clone

CAT#: SC325516

DAZAP2 (untagged)-Human DAZ associated protein 2 (DAZAP2), transcript variant 2


  "NM_001136264" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DAZAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DAZAP2
Synonyms PRTB
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001136264, the custom clone sequence may differ by one or more nucleotides
ATGAACAGCAAAGGTCAATATCCAACACAGCCAACCTACCCTGTGCAGCCTCCTGGGAAT
CCAGTATACCCTCAGACCTTGCATCTTCCTCAGGCTCCACCCTATACCGATGCTCCACCT
GCCTACTCAGAGCTCTATCGTCCGAGCTTTGTGCACCCAGGGGCTGCCACAGTCCCCACC
ATGTCAGCCGCAATCCCCATGGCTTATTATCCAGTCGGTCCCATCTATCCACCTGGCTCC
ACAGTGCTGGTGGAAGGAGGGTATGATGCAGGTGCCAGATTTGGAGCTGGGGCTACTGCT
GGCAACATTCCTCCTCCACCTCCTGGATGCCCTCCCAATGCTGCTCAGCTTGCAGTCATG
CAGGGAGCCAACGTCCTCGTAACTCAGCGGAAGGGGAACTTCTTCATGGGTGGTTCAGAT
GGTGGCTACACCATCTGG
Restriction Sites Please inquire     
ACCN NM_001136264
ORF Size 441 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001136264.1, NP_001129736.1
RefSeq Size 2116
RefSeq ORF 441
Locus ID 9802
Gene Summary This gene encodes a proline-rich protein which interacts with the deleted in azoospermia (DAZ) and the deleted in azoospermia-like gene through the DAZ-like repeats. This protein also interacts with the transforming growth factor-beta signaling molecule SARA (Smad anchor for receptor activation), eukaryotic initiation factor 4G, and an E3 ubiquitinase that regulates its stability in splicing factor containing nuclear speckles. The encoded protein may function in various biological and pathological processes including spermatogenesis, cell signaling and transcription regulation, formation of stress granules during translation arrest, RNA splicing, and pathogenesis of multiple myeloma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (2) lacks an in-frame segment in an internal coding exon, compared to variant 1, resulting in a shorter protein (isoform b) compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.