DAZAP2 (NM_001136264) Human Untagged Clone
CAT#: SC325516
DAZAP2 (untagged)-Human DAZ associated protein 2 (DAZAP2), transcript variant 2
"NM_001136264" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DAZAP2 |
Synonyms | PRTB |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001136264, the custom clone sequence may differ by one or more nucleotides
ATGAACAGCAAAGGTCAATATCCAACACAGCCAACCTACCCTGTGCAGCCTCCTGGGAAT CCAGTATACCCTCAGACCTTGCATCTTCCTCAGGCTCCACCCTATACCGATGCTCCACCT GCCTACTCAGAGCTCTATCGTCCGAGCTTTGTGCACCCAGGGGCTGCCACAGTCCCCACC ATGTCAGCCGCAATCCCCATGGCTTATTATCCAGTCGGTCCCATCTATCCACCTGGCTCC ACAGTGCTGGTGGAAGGAGGGTATGATGCAGGTGCCAGATTTGGAGCTGGGGCTACTGCT GGCAACATTCCTCCTCCACCTCCTGGATGCCCTCCCAATGCTGCTCAGCTTGCAGTCATG CAGGGAGCCAACGTCCTCGTAACTCAGCGGAAGGGGAACTTCTTCATGGGTGGTTCAGAT GGTGGCTACACCATCTGG |
Restriction Sites | Please inquire |
ACCN | NM_001136264 |
ORF Size | 441 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001136264.1, NP_001129736.1 |
RefSeq Size | 2116 |
RefSeq ORF | 441 |
Locus ID | 9802 |
Gene Summary | This gene encodes a proline-rich protein which interacts with the deleted in azoospermia (DAZ) and the deleted in azoospermia-like gene through the DAZ-like repeats. This protein also interacts with the transforming growth factor-beta signaling molecule SARA (Smad anchor for receptor activation), eukaryotic initiation factor 4G, and an E3 ubiquitinase that regulates its stability in splicing factor containing nuclear speckles. The encoded protein may function in various biological and pathological processes including spermatogenesis, cell signaling and transcription regulation, formation of stress granules during translation arrest, RNA splicing, and pathogenesis of multiple myeloma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (2) lacks an in-frame segment in an internal coding exon, compared to variant 1, resulting in a shorter protein (isoform b) compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227525 | DAZAP2 (Myc-DDK-tagged)-Human DAZ associated protein 2 (DAZAP2), transcript variant 2 |
USD 420.00 |
|
RG227525 | DAZAP2 (GFP-tagged) - Human DAZ associated protein 2 (DAZAP2), transcript variant 2 |
USD 460.00 |
|
RC227525L3 | Lenti-ORF clone of DAZAP2 (Myc-DDK-tagged)-Human DAZ associated protein 2 (DAZAP2), transcript variant 2 |
USD 620.00 |
|
RC227525L4 | Lenti-ORF clone of DAZAP2 (mGFP-tagged)-Human DAZ associated protein 2 (DAZAP2), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review