BEAN1 (NM_001136106) Human Untagged Clone

CAT#: SC325520

BEAN1 (untagged)-Human brain expressed, associated with NEDD4, 1 (BEAN1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BEAN1
• Synonyms: BEAN; SCA31
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001136106, the custom clone sequence may differ by one or more nucleotides
  ATGCGCTATGCCTGCAGCTCCTCAGAGGACTGGCCCCCACCCTTGGACATCAGCTCTGAC
  GGGGACGTGGATGCCACGGTGCTCAGGGAGCTGTACCCAGATTCTCCACCAGGCTACGAG
  GAGTGTGTGGGGCCAGGGGCCACTCAGCTGTATGTCCCCACGGACGCACCACCACCCTAC
  TCGCTGACTGATTCCTGCCCCACGCTGGATGGCACCTCCGACTCAGGCAGCGGCCACAGC
  CCTGGCCGACACCAGCAGGAGCAGAGGACCCCGGCCCAAGGTGGCCTTCACACGGTCTCC
  ATGGACACCCTTCCCCCCTACGAGGCTGTGTGCGGGGCTGGCCCCCCATCAGGCCTGCTG
  CCACTGCCGGGCCCAGACCCAGGGCCAAGGGGCTCCCAGGGCTCACCCACCCCAACCCGG
  GCCCCAGCCTCTGGCCCAGAGAGGATTGTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001136106
• ORF Size: 453 bp
• Insert Size: 2824
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001136106.2, NP_001129578.1
• RefSeq Size: 2824
• RefSeq ORF: 453
• Locus ID: 146227
• Protein Families: Transmembrane
• Gene Summary: The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1.