MYL12B (NM_001144946) Human Untagged Clone

CAT#: SC325526

MYL12B (untagged)-Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MYL12B
• Synonyms: MLC-B; MRLC2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001144946, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGAGCATGTTTGCCATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTG
  ATCAGAACAGAGATGGCTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCC
  CACTGATGCATACCTTGATGCCATGATGAATGAGGCCCCAGGGCCCATCAATTTCACCATGTTCCTGACC
  ATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAACGCCTTTGCTTGCTTTGATG
  AAGAAGCAACAGGCACCATTCAGGAAGATTACCTAAGAGAGCTGCTGACAACCATGGGGGATCGGTTTAC
  AGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGGAATTTCAATTACATCGAG
  TTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001144946
• ORF Size: 465 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001144946.1, NP_001138418.1
• RefSeq Size: 968
• RefSeq ORF: 465
• Locus ID: 103910
• Protein Pathways: Focal adhesion, Leukocyte transendothelial migration, Regulation of actin cytoskeleton, Tight junction
• Gene Summary: The activity of nonmuscle myosin II (see MYH9; MIM 160775) is regulated by phosphorylation of a regulatory light chain, such as MRLC2. This phosphorylation results in higher MgATPase activity and the assembly of myosin II filaments (Iwasaki et al., 2001 [PubMed 11942626]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (4) differs in the 5' UTR and lacks an in-frame exon region, compared to variant 1. These differences result in a shorter protein (isoform B), compared to isoform A.