DUSP19 (NM_001142314) Human Untagged Clone

CAT#: SC325547

DUSP19 (untagged)-Human dual specificity phosphatase 19 (DUSP19), transcript variant 2


  "NM_001142314" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DUSP19"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DUSP19
Synonyms DUSP17; LMWDSP3; SKRP1; TS-DSP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001142314, the custom clone sequence may differ by one or more nucleotides


ATGTACTCCCTTAACCAGGAAATTAAAGCATTCTCCCGGAATAATCTCAGGAAGCAATGCACCAGGGTGA
CAACGCTAACTGGAAAGAAAATTATAGAAACATGGAAAGATGCCAGAATTCATGTTGTGGAAGAAGTAGA
GCCGAGCAGTGGGGGTGGTTGTGGTTATGTGCAGGACCTTAGCTCGGACCTGCAAGTTGGCGTTATTAAG
CCATGGTTGCTCCTAGGGTCACAAGATGCTGCTCATGATTTGGATACACTGAAAAAGAATAAGGATGGAG
TGGTTCTTGTTCATTGTAATGCAGGCGTTTCCAGGGCTGCTGCAATTGTAATAGGTTTCCTGATGAATTC
TGAACAAACCTCATTTACCAGTGCTTTTTCTTTGGTGAAAAATGCAAGACCTTCCATATGTCCAAATTCT
GGCTTCATGGAGCAGCTTCGTACATATCAAGAGGGCAAAGAAAGCAATAAGTGTGACAGAATACAGGAGA
ACAGTTCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001142314
ORF Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001142314.1, NP_001135786.1
RefSeq Size 5226
RefSeq ORF 501
Locus ID 142679
Protein Families Druggable Genome, Phosphatase
Gene Summary Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP19 contains a variation of the consensus DUSP C-terminal catalytic domain, with the last serine residue replaced by alanine, and lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 [PubMed 19228121]). [supplied by OMIM, Dec 2009]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the mid coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.