DUSP19 (NM_001142314) Human Untagged Clone

CAT#: SC325547

DUSP19 (untagged)-Human dual specificity phosphatase 19 (DUSP19), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DUSP19
• Synonyms: DUSP17; LMWDSP3; SKRP1; TS-DSP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142314, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACTCCCTTAACCAGGAAATTAAAGCATTCTCCCGGAATAATCTCAGGAAGCAATGCACCAGGGTGA
  CAACGCTAACTGGAAAGAAAATTATAGAAACATGGAAAGATGCCAGAATTCATGTTGTGGAAGAAGTAGA
  GCCGAGCAGTGGGGGTGGTTGTGGTTATGTGCAGGACCTTAGCTCGGACCTGCAAGTTGGCGTTATTAAG
  CCATGGTTGCTCCTAGGGTCACAAGATGCTGCTCATGATTTGGATACACTGAAAAAGAATAAGGATGGAG
  TGGTTCTTGTTCATTGTAATGCAGGCGTTTCCAGGGCTGCTGCAATTGTAATAGGTTTCCTGATGAATTC
  TGAACAAACCTCATTTACCAGTGCTTTTTCTTTGGTGAAAAATGCAAGACCTTCCATATGTCCAAATTCT
  GGCTTCATGGAGCAGCTTCGTACATATCAAGAGGGCAAAGAAAGCAATAAGTGTGACAGAATACAGGAGA
  ACAGTTCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142314
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142314.1, NP_001135786.1
• RefSeq Size: 5226
• RefSeq ORF: 501
• Locus ID: 142679
• Protein Families: Druggable Genome, Phosphatase
• Gene Summary: Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP19 contains a variation of the consensus DUSP C-terminal catalytic domain, with the last serine residue replaced by alanine, and lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 [PubMed 19228121]). [supplied by OMIM, Dec 2009]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the mid coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.