RNF24 (NM_001134338) Human Untagged Clone

CAT#: SC325552

RNF24 (untagged)-Human ring finger protein 24 (RNF24), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNF24
• Synonyms: G1L
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001134338, the custom clone sequence may differ by one or more nucleotides
  ATGTTGAATAAGAGTGGTGAGAGCAGATATCCTGCCTTGTTCCCGGTCTTAGGGGGTTCA
  TCCATGAGCTCGGATTTCCCACATTACAACTTCAGGATGCCTAATATTGGATTCCAGAAT
  CTGCCTCTCAACATATATATTGTGGTTTTTGGTACTGCTATATTTGTCTTCATCCTTAGT
  TTACTCTTCTGTTGCTACTTGATTAGGCTAAGACATCAAGCACACAAAGAATTTTATGCC
  TACAAACAGGTTATATTAAAAGAGAAAGTAAAAGAATTGAATTTACATGAGCTCTGTGCA
  GTGTGCCTAGAAGACTTCAAGCCTCGAGATGAGTTGGGGATTTGCCCATGTAAGCACGCC
  TTCCACAGAAAGTGCCTTATTAAGTGGCTGGAGGTTCGTAAAGTGTGTCCCCTGTGCAAC
  ATGCCAGTTCTACAGCTGGCCCAGTTGCACAGTAAGCAGGACCGTGGACCCCCTCAGGGG
  CCCCTTCCTGGGGCAGAGAACATTGTA
  
• Restriction Sites: Please inquire
• ACCN: NM_001134338
• ORF Size: 510 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001134338.1, NP_001127810.1
• RefSeq Size: 3313
• RefSeq ORF: 510
• Locus ID: 11237
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes an integral membrane protein that contains a RING-type zinc finger. The encoded protein may interact with multiple transient receptor potential cation channel subfamily C (TRPC) proteins and regulate the trafficking and insertion of these proteins into the plasma membrane. [provided by RefSeq, Mar 2016]
  Transcript Variant: This variant (3) contains a different segment for its 5' UTR and includes an alternate segment which uses an upstream AUG codon, compared to variant 1. The resulting isoform (2) has a longer N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.