Glutathione S Transferase kappa 1 (GSTK1) (NM_001143681) Human Untagged Clone

CAT#: SC325572

GSTK1 (untagged)-Human glutathione S-transferase kappa 1 (GSTK1), nuclear gene encoding mitochondrial protein, transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GSTK1
• Synonyms: GST; GST13; GST 13-13; GST13-13; GSTK1-1; hGSTK1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001143681, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGCCCCTGCCGCGCACCGTGGAGCTCTTCTATGACGTGCTGTCCCCCTACTCCTGGCTGGGCTTCG
  AGATCCTGTGCCGGTATCAGAATATCTGGAACATCAACCTGCAGTTGCGGCCCAGCCTCATAACAGGGAT
  CATGAAAGACAGTGGAAGTTTGTCTGCCATGCGTTTCCTCACCGCCGTGAACTTGGAGCATCCAGAGATG
  CTGGAGAAAGCGTCCCGGGAGCTGTGGATGCGCGTCTGGTCAAGGAATGAAGACATCACCGAGCCGCAGA
  GCATCCTGGCGGCTGCAGAGAAGGCTGGTATGTCTGCAGAACAAGCCCAGGGACTTCTGGAAAAGATCGC
  AACGCCAAAGGTGAAGAACCAGCTCAAGGAGACCACTGAGGCAGCCTGCAGATACGGAGCCTTTGGGCTG
  CCCATCACCGTGGCCCATGTGGATGGCCAAACCCACATGTTATTTGGCTCTGACCGGATGGAGCTGCTGG
  CGCACCTGCTGGGAGAGAAGTGGATGGGCCCTATACCTCCAGCCGTGAATGCCAGACTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001143681
• ORF Size: 552 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001143681.1, NP_001137153.1
• RefSeq Size: 929
• RefSeq ORF: 552
• Locus ID: 373156
• Protein Pathways: Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
• Gene Summary: This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
  Transcript Variant: This variant (4) lacks an exon in the coding region compared to variant 1. The encoded protein (isoform d) is shorter compared to isoform a.