RIC3 (NM_001135109) Human Untagged Clone

CAT#: SC325576

RIC3 (untagged)-Human resistance to inhibitors of cholinesterase 3 homolog (C. elegans) (RIC3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RIC3
• Synonyms: AYST720; PRO1385
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135109, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGTACTCCACAGTGCAGAGAGTCGCTCTGGCTTCTGGGCTTGTCCTGGCTCTGTCGCTGCTGCTGC
  CCAAGGCCTTCCTGTCCCGCGGGAAGCGGCAGGAGCCGCCGCCGACACCTGAAGGTTACCCTGAAGAGAC
  TTACCCAATTTATGACCTTTCAGACTGTATCAAGCGTAGGCAAGAAACAATCTTGGTGGATTACCCTGAC
  CCAAAAGAACTTTCTGCTGAAGAAATAGCTGAAAGAATGGGAATGATAGAAGAGGAAGAATCAGATCATT
  TGGGTTGGGAAAGTCTGCCCACTGACCCCAGAGCCCAGGAAGATAATTCTGTTACCTCGTGTGATCCAAA
  GCCAGAAACATGTTCCTGCTGTTTTCATGAAGACGAGGATCCTGCTGTCTTGGCAGAGAATGCTGGATTC
  AGTGCAGATAGCTACCCTGAGCAAGAGGAAACCACCAAAGAAGAGTGGTCCCAAGACTTTAAAGATGAAG
  GGTTGGGCATCAGCACCGATAAAGCATATACAGGCAGCATGCTGAGGAAGCGTAACCCCCAGGGTTTAGA
  GTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135109
• ORF Size: 564 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135109.2, NP_001128581.1
• RefSeq Size: 5284
• RefSeq ORF: 564
• Locus ID: 79608
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
  Transcript Variant: This variant (2) lacks four consecutive exons in the coding region, compared to variant 1. The encoded isoform (f) is shorter than isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.