MAD3 (MXD3) (NM_001142935) Human Untagged Clone

CAT#: SC325583

MXD3 (untagged)-Human MAX dimerization protein 3 (MXD3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MXD3
• Synonyms: BHLHC13; MAD3; MYX
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001142935 edited
  GCTTGCTCCGGCCGGCACCCTAGGCCGGCCCGCCGCCAGCTGTCGCCGACATGGAACCCT
  TGGCCAGCAACATCCAGGTCCTGCTGCAGGCGGCCGAGTTCCTGGAGCGCCGTGAGAGAG
  AGGCCGAGCATGGTTATGCGTCCCTGTGCCCGCATCGCAGTCCAGGCCCCATCCACAGGA
  GGAAGAAGCGACCCCCCCAGGCTCCTGGCGCGCAGGACAGCGGGCGGTCAGTGCACAATG
  AACTGGAGAAGCGCAGGAGGGCCCAGTTGAAGCGGTGCCTGGAGCGGCTGAAGCAGCAGA
  TGCCCCTGGGGGCCGACTGTGCCCGGTACACCACGCTGAGCCTGCTGCGCCGTGCCAGGA
  TGCACATCCAGAAGCTGGAGGATCAGGAGCAGCGGGCCCGACAGCTCAAGGAGAGGCTGC
  GCAGCAAGCAGCAGAGCCTGCAGCGGCAGCTGGAGCAGCTCCGGGGGCTGGCAGGGGCGG
  CCGAGCGGGAGCGGCTGCGGGCGGACAGTCTGGACTCCTCAGGCCTCTCCTCTGAGCGCT
  CAGACTCAGACCAAGTCTTGCCTAATGAAAACGGGGGAACTCCCAACCACAGACCCACTG
  GAAGAGGAAATAATATCAGTTCCCATCACTGAC
  
• Restriction Sites: Please inquire
• ACCN: NM_001142935
• ORF Size: 582 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142935.1, NP_001136407.1
• RefSeq Size: 2662
• RefSeq ORF: 582
• Locus ID: 83463
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a member of the Myc superfamily of basic helix-loop-helix leucine zipper transcriptional regulators. The encoded protein forms a heterodimer with the cofactor MAX which binds specific E-box DNA motifs in the promoters of target genes and regulates their transcription. Disruption of the MAX-MXD3 complex is associated with uncontrolled cell proliferation and tumorigenesis. Transcript variants of this gene encoding different isoforms have been described. [provided by RefSeq, Dec 2008]
  Transcript Variant: This variant (2) differs in the 3' UTR and 3' coding region compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.