HSD3B7 (NM_001142777) Human Untagged Clone

CAT#: SC325588

HSD3B7 (untagged)-Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 (HSD3B7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HSD3B7
• Synonyms: CBAS1; PFIC4; SDR11E3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142777, the custom clone sequence may differ by one or more nucleotides
  ATGGCCGACTCTGCACAGGCCCAGAAGCTGGTGTACCTGGTCACAGGGGGCTGTGGCTTC
  CTGGGAGAGCACGTGGTGCGAATGCTGCTGCAGCGGGAGCCCCGGCTCGGGGAGCTGCGG
  GTCTTTGACCAACACCTGGGTCCCTGGCTGGAGGAGCTGAAGACAGGGCCTGTGAGGGTG
  ACTGCCATCCAGGGGGACGTGACCCAGGCCCATGAGGTGGCAGCAGCTGTGGCCGGAGCC
  CATGTGGTCATCCACACGGCTGGGCTGGTAGACGTGTTTGGCAGGGCCAGTCCCAAGACC
  ATCCATGAGGTCAACGTGCAGGGTACCCGGAACGTGATCGAGGCTTGTGTGCAGACCGGA
  ACACGGTTCCTGGTCTACACCAGCAGCATGGAAGTTGTGGGGCCTAACACCAAAGGTCAC
  CCCTTCTACAGGGGCAACGAAGACACCCCATACGAAGCAGTGCACAGGCACCCCTATCCT
  TGCAGCAAGGCCCTGGCCGAGTGGCTGGTCCTGGAGGCCAACGGGAGGAAGGCAATGTTG
  CCTGGATGCACGTGCTGGCAGCCCGGGAGCTGGAGCAGCGGGCAACCC
  
• Restriction Sites: Please inquire
• ACCN: NM_001142777
• ORF Size: 591 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142777.1, NP_001136249.1
• RefSeq Size: 2233
• RefSeq ORF: 591
• Locus ID: 80270
• Protein Families: Transmembrane
• Protein Pathways: Metabolic pathways, Primary bile acid biosynthesis
• Gene Summary: This gene encodes an enzyme which is involved in the initial stages of the synthesis of bile acids from cholesterol and a member of the short-chain dehydrogenase/reductase superfamily. The encoded protein is a membrane-associated endoplasmic reticulum protein which is active against 7-alpha hydrosylated sterol substrates. Mutations in this gene are associated with a congenital bile acid synthesis defect which leads to neonatal cholestasis, a form of progressive liver disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
  Transcript Variant: This variant (2) differs in the 5'UTR and lacks an exon in the 3' coding region which results in a frameshift and an early stop codon, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. Variants 2 and 3 encode the same protein.