HSD3B7 (NM_001142778) Human Untagged Clone

CAT#: SC325589

HSD3B7 (untagged)-Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 (HSD3B7), transcript variant 3


  "NM_001142778" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSD3B7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HSD3B7
Synonyms CBAS1; PFIC4; SDR11E3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001142778, the custom clone sequence may differ by one or more nucleotides
ATGGCCGACTCTGCACAGGCCCAGAAGCTGGTGTACCTGGTCACAGGGGGCTGTGGCTTC
CTGGGAGAGCACGTGGTGCGAATGCTGCTGCAGCGGGAGCCCCGGCTCGGGGAGCTGCGG
GTCTTTGACCAACACCTGGGTCCCTGGCTGGAGGAGCTGAAGACAGGGCCTGTGAGGGTG
ACTGCCATCCAGGGGGACGTGACCCAGGCCCATGAGGTGGCAGCAGCTGTGGCCGGAGCC
CATGTGGTCATCCACACGGCTGGGCTGGTAGACGTGTTTGGCAGGGCCAGTCCCAAGACC
ATCCATGAGGTCAACGTGCAGGGTACCCGGAACGTGATCGAGGCTTGTGTGCAGACCGGA
ACACGGTTCCTGGTCTACACCAGCAGCATGGAAGTTGTGGGGCCTAACACCAAAGGTCAC
CCCTTCTACAGGGGCAACGAAGACACCCCATACGAAGCAGTGCACAGGCACCCCTATCCT
TGCAGCAAGGCCCTGGCCGAGTGGCTGGTCCTGGAGGCCAACGGGAGGAAGGCAATGTTG
CCTGGATGCACGTGCTGGCAGCCCGGGAGCTGGAGCAGCGGGCAACCC
Restriction Sites Please inquire     
ACCN NM_001142778
ORF Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001142778.1, NP_001136250.1
RefSeq Size 2040
RefSeq ORF 591
Locus ID 80270
Protein Families Transmembrane
Protein Pathways Metabolic pathways, Primary bile acid biosynthesis
Gene Summary This gene encodes an enzyme which is involved in the initial stages of the synthesis of bile acids from cholesterol and a member of the short-chain dehydrogenase/reductase superfamily. The encoded protein is a membrane-associated endoplasmic reticulum protein which is active against 7-alpha hydrosylated sterol substrates. Mutations in this gene are associated with a congenital bile acid synthesis defect which leads to neonatal cholestasis, a form of progressive liver disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (3) lacks an exon in the 3' coding region which results in a frameshift and an early stop codon, compared to variant (1), resulting in a shorter protein (isoform b), compared to isoform a. Variants 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.