PPP1R14D (NM_001130143) Human Untagged Clone

CAT#: SC325595

PPP1R14D (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14D (PPP1R14D), transcript variant 2


  "NM_001130143" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPP1R14D"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPP1R14D
Synonyms CPI17-like; GBPI-1; GBPI1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001130143, the custom clone sequence may differ by one or more nucleotides
ATGCTGTCTTCAAGCCCTGCTTCCTGCACATCTCCCAGCCCAGATGGGGAGAACCCATGT
AAGAAGGTCCACTGGGCTTCTGGGAGGAGAAGGACATCATCCACAGACTCAGAGTCCAAG
TCCCACCCGGACTCCTCCAAGATACCCAGGTCCCGGAGACCCAGCCGCCTGACAGTGAAG
TATGACCGGGGCCAGCTCCAGCGCTGGCTGGAGATGGAGCAATGGGTGGATGCTCAAGTT
CAGGAGCTCTTCCAGAGTCTTGCTCTGTCACCCAGGCTGGAGTGCAGTGGTGTGATCCAT
TCTCTGCAACTTCTGCCTCCCGGGTTCAATCGATTCTCCTGCCTCAGCTCCTGGAGTAGC
TGGGATTACGGGATCAAGCAACCCCTTCTGAGCCTGAGATTGACCTGGAAGCTCTCATGG
ATCTATCCACAGAGGAGCAGAAGACTCAGCTGGAGGCCATTCTTGGGAACTGCCCCCGCC
CCACAGAGGCTTTTATCTCTGAGCTGCTCAGTCAACTCAAGAAACTCCGGAGACTCAGCC
GGCCTCAGAAATAAGCCTGAGAGACCATCTTTAGCAGCCTCAGCACTGCCAGGCCTGCCC
Restriction Sites Please inquire     
ACCN NM_001130143
ORF Size 603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001130143.1, NP_001123615.1
RefSeq Size 880
RefSeq ORF 603
Locus ID 54866
Protein Families Druggable Genome
Gene Summary Protein phosphatase-1 (PP1; see MIM 176875) is a major cellular phosphatase that reverses serine/threonine protein phosphorylation. PPP1R14D is a PP1 inhibitor that itself is regulated by phosphorylation (Liu et al., 2004 [PubMed 12974676]). [supplied by OMIM, Feb 2010]
Transcript Variant: This variant (2) represents the longer transcript and encodes the longer isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.