DAZAP2 (NM_001136266) Human Untagged Clone

CAT#: SC325606

DAZAP2 (untagged)-Human DAZ associated protein 2 (DAZAP2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DAZAP2
• Synonyms: PRTB
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001136266, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACAGCAAAGGTCAATATCCAACACAGCCAACCTACCCTGTGCAGCCTCCTGGGAATCCAGTATACC
  CTCAGACCTTGCATCTTCCTCAGGCTCCACCCTATACCGATGCTCCACCTGCCTACTCAGAGCTCTATCG
  TCCGAGCTTTGTGCACCCAGGGGCTGCCACAGTCCCCACCATGTCAGCCGCATTTCCTGGAGCCTCTCTG
  TATCTTCCCATGGCCCAGTCTGTGGCTGTTGGGCCTTTAGGTTCCACAATCCCCATGGCTTATTATCCAG
  TCGGTCCCATCTATCCACCTGCCTCCACCTCCTGGATGCCCTCCCAATGCTGCTCAGCTTGCAGTCATGC
  AGGGAGCCAACGTCCTCGTAACTCAGCGGAAGGGGAACTTCTTCATGGGTGGTTCAGATGGTGGCTACAC
  CATCTGGTGAGGAACCAAGGCCACCTCTGTGCCGGGAAAGACATCACATACCTTCAGCACTTCTCACAAT
  GTAACTGCTTTAGTCATATTAACCTGAAGTTGCAGTTTAGACACATGTTGTTGGGGTGTCTTTCTGGTGC
  CCAAACTTTCAGGCACTTTTCAAATTTAATAAGGAACCATGTAATGGTAGCAGTACCTCCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001136266
• ORF Size: 624 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001136266.1, NP_001129738.1
• RefSeq Size: 2105
• RefSeq ORF: 624
• Locus ID: 9802
• Gene Summary: This gene encodes a proline-rich protein which interacts with the deleted in azoospermia (DAZ) and the deleted in azoospermia-like gene through the DAZ-like repeats. This protein also interacts with the transforming growth factor-beta signaling molecule SARA (Smad anchor for receptor activation), eukaryotic initiation factor 4G, and an E3 ubiquitinase that regulates its stability in splicing factor containing nuclear speckles. The encoded protein may function in various biological and pathological processes including spermatogenesis, cell signaling and transcription regulation, formation of stress granules during translation arrest, RNA splicing, and pathogenesis of multiple myeloma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
  Transcript Variant: This variant (3) uses an alternate splice site in a coding exon, compared to variant 1, that results in a frameshift. It encodes isoform c which has a longer and distinct C-terminus compared to isoform a.