LGSN (NM_001143940) Human Untagged Clone

CAT#: SC325608

LGSN (untagged)-Human lengsin, lens protein with glutamine synthetase domain (LGSN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LGSN
• Synonyms: GLULD1; LGS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001143940, the custom clone sequence may differ by one or more nucleotides
  ATGAATAATGAAGAGGACCTTCTGCAGGAGGACTCAACAAGAGATGAAGGCAATGAGACT
  GAAGCCAACAGCATGAACACATTAAGAAGGACAAGGAAGAAAGTCACTAAACCATATGTT
  TGTTCAACTGAAGTGGGAGAAACGGATATGTCCAATTCAAATGATTGCATGAGGGACAGC
  AGTCAAATTTTGACCCCACCTCAACTCTCTTCTAGAATGAAACACATTAGACAAGCCATG
  GCCAAAAATCGCCTCCAGTTTGTACGATTTGAAGCAACAGACCTCCACGGCGTGTCCAGG
  TCTAAGACTATCCCTGCACACTTTTTTCAAGAGAAAGTGAGCCATGGTGTTTGCATGCCC
  CGAGGTTATCTTGAAGTGATACCAAATCCAAAGGACAATGAAATGAATAACATAAGAGCC
  ACATGTTTTAATAGCGACATAGTCCTAATGCCAGAGTTATCAACCTTTAGAGTTTTGCCA
  TGGGCTGACAGAACTGCAAGAGTGATATGTGATACCTTCACTGTGACTGTCTCTGGGATG
  TCGATAGGAAGAAAAACATGTTCTGCAGCACTTCTGGAACTGAGCAGCTCACGATCACTG
  GGAAAAAATGGTTGGCAGGACTCT
  
• Restriction Sites: Please inquire
• ACCN: NM_001143940
• ORF Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001143940.1, NP_001137412.1
• RefSeq Size: 5213
• RefSeq ORF: 627
• Locus ID: 51557
• Gene Summary: This gene encodes a protein with similarity to the GS I members of the glutamine synthetase superfamily. The encoded protein is referred to as a pseudo-glutamine synthetase because it has no glutamine synthesis activity and may function as a chaperone protein. This protein is localized to the lens and may be associated with cataract disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
  Transcript Variant: This variant (2) lacks an alternate segment of the 3' coding region, compared to variant 1, that causes a frameshift. The resulting protein (isoform b) has a distinct C-terminus, compared to isoform a. Sequence Note:This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene The extent of this transcript is supported by transcript alignments.