NEIL2 (NM_001135748) Human Untagged Clone

CAT#: SC325616

NEIL2 (untagged)-Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 4


  "NM_001135748" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NEIL2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NEIL2
Synonyms NEH2; NEI2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001135748, the custom clone sequence may differ by one or more nucleotides


ATGCCAGAAGGGCCGTTGGTGAGGAAATTTCACCATTTGGTCTCCCCCTTTGTGGGTCAGCAGGTGGTCA
AGACAGGGGGCAGCAGTAAGAAGCTACAGCCCGCCAGCCTGCAGTCTCTGTGGCTCCAGGACACCCAGGT
GAGGTTGGTCCTGCACTTTGGTGGTGGTGGCTTCCTGGCATTTTATAATTGTCAGTTGTCTTGGAGCTCT
TCCCCAGTGGTCACACCCACCTGTGACATCCTGTCTGAGAAGTTCCATCGAGGACAAGCCTTAGAAGCTC
TAGGCCAGGCTCAGCCTGTCTGCTATACACTGCTGGACCAGAGATACTTCTCAGGGCTAGGGAACATCAT
TAAGAATGAAGCCTTGTACAGAGCTGGGATCCATCCCCTTTCTCTCGGTTCAGTCCTGAGTGCCTCGCGT
CGGGAGGTCCTGGTGGATCACGTGGTGGAGTTCAGTACAGCCTGGCTGCAGGGCAAGTTCCAAGGCAGAC
CGCAGCACACACAGGTCTACCAGAAAGAACAGTGCCCTGCTGGCCACCAGGTCATGAAGGAGGCGTTTGG
GCCCGAAGATGGGTTACAGAGGCTCACCTGGTGGTGCCCGCAGTGCCAGCCCCAGTTGTCAGAGGAGCCA
GAGCAGTGCCAGTTCTCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001135748
ORF Size 651 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001135748.1, NP_001129220.1
RefSeq Size 2016
RefSeq ORF 651
Locus ID 252969
Protein Families Druggable Genome
Protein Pathways Base excision repair
Gene Summary This gene encodes a member of the Fpg/Nei family of DNA glycosylases. These glycosylases initiate the first step in base excision repair by cleaving oxidatively damaged bases and introducing a DNA strand break via their abasic site lyase activity. This enzyme is primarily associated with DNA repair during transcription and acts prefentially on cytosine-derived lesions, particularly 5-hydroxyuracil and 5-hydroxycytosine. It contains an N-terminal catalytic domain, a hinge region, and a C-terminal DNA-binding domain with helix-two-turn-helix and zinc finger motifs. This enzyme interacts with the X-ray cross complementing factor 1 scaffold protein as part of a multi-protein DNA repair complex. A pseudogene of this gene has been identified. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks an alternate exon compared to variant 1. The encoded isoform (c) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.