CITED1 (NM_001144885) Human Untagged Clone

CAT#: SC325620

CITED1 (untagged)-Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 2


  "NM_001144885" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CITED1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CITED1
Synonyms MSG1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001144885, the custom clone sequence may differ by one or more nucleotides
ATGGAACCATCCGCACAACAGCTCCAGCTGGCAGCATCACTTCCCGCCAATTTATCCAAC
TTCTGCCAAGGCTCTGAAATGCCAACAACGTCGAGGCCTGCACTTGATGTCAAGGGTGGC
ACCTCACCTGCGAAGGAGGATGCCAACCAAGAGATGAGCTCCGTGGCCTACTCCAACCTT
GCGGTGAAAGATCGCAAAGCAGTGGCCATTCTGCACTACCCTGGGGTAGCCTCAAATGGA
ACCAAGGCCAGTGGGGCTCCCACTAGTTCCTCGGGATCTCCAATAGGCTCTCCTACAACC
ACCCCTCCCACTAAACCCCCATCCTTCAACCTGCACCCCGCCCCTCACTTGCTGGCTAGT
ATGCACCTGCAGAAACTTAATAGCCAGTATCAGGGGATGGCTGCTGCCACTCCAGGCCAA
CCCGGGGAGGCAGGACCCCTGCAAAACTGGGACTTTGGGGCCCAGGCGGGAGGGGCAGAA
TCACTCTCTCCTTCTGCTGGTGCCCAGAGCCCTGCTATCATCGATTCGGACCCAGTGGAT
GAGGAAGTGCTGATGTCGCTGGTGGTGGAACTGGGGTTGGACCGAGCCAATGAGCTTCCG
GAGCTGTGGCTGGGGCAGAATGAGTTTGACTTCACTGCGGACTTTCCATCTAGCTGC
Restriction Sites Please inquire     
ACCN NM_001144885
ORF Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001144885.1, NP_001138357.1
RefSeq Size 951
RefSeq ORF 660
Locus ID 4435
Protein Families Transcription Factors
Gene Summary This gene encodes a member of the CREB-binding protein/p300-interacting transactivator with Asp/Glu-rich C-terminal domain (CITED) family of proteins. The encoded protein, also known as melanocyte-specific gene 1, may function as a transcriptional coactivator and may play a role in pigmentation of melanocytes. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Transcript Variant: This variant (2) contains a distinct 5' UTR and 5' coding region due to the presence of two alternate exons. These differences cause translation initiation at an upstream AUG and result in an isoform (2) with a longer N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.