RIZ1 (PRDM2) (NM_001135610) Human Untagged Clone

CAT#: SC325626

PRDM2 (untagged)-Human PR domain containing 2, with ZNF domain (PRDM2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRDM2
• Synonyms: HUMHOXY1; KMT8; KMT8A; MTB-ZF; RIZ; RIZ1; RIZ2
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001135610 edited
  ATGAATCAGAACACTACTGAGCCTGTGGCGGCCACCGAGACCCTGGCTGAGGTACCCGAA
  CATGTGCTGCGAGGACTTCCGGAGGAAGTGAGGCTTTTCCCTTCTGCTGTTGACAAGACC
  CGGATTGGTGTCTGGGCCACTAAACCAATTTTAAAAGGCAAAAAATTTGGGCCATTTGTT
  GGTGATAAGAAAAAAAGATCTCAGGTTAAGAATAATGTATACATGTGGGAGGTGTATTAC
  CCAAATTTGGGATGGATGTGCATTGATGCCACTGATCCAGAGAAGGGAAACTGGCTGCGA
  TATGTGAATTGGGCTTGCTCAGGAGAAGAGCAAAATTTATTCCCACTGGAAATCAACAGA
  GCCATTTACTATAAAACTTTAAAGCCAATCGCGCCGGGCGAGGAGCTCCTGGTCTGGTAC
  AATGGGGAAGACAACCCTGAGATAGCAGCTGCGATTGAGGAAGAGCGAGCCAGCGCCCGG
  AGCAAGCGGAGCTCCCCCAAGAGCCGGAAAGCTACAGCCTCCGCTTGGCGTCCCGATGCT
  CTCCACCAGCGGCCCCGTACATCACCAGGCAGTATAGGAAGGTCAAAGCTCCAGCTGCAG
  CCCAGTTCCAGGGACCATTCTTCAAAGAGTAGACACTCTGGCTGCTCCCTGACAGCACCT
  GAAGTGACCTGGAATCAGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001135610
• ORF Size: 681 bp
• Insert Size: 1200
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135610.1, NP_001129082.1
• RefSeq Size: 2715
• RefSeq ORF: 681
• Locus ID: 7799
• Protein Families: Druggable Genome
• Gene Summary: This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
  Transcript Variant: This variant (4) has an alternate 5' UTR and lacks two internal coding exons compared to variant 1. The resulting isoform (d) is much shorter and has a distinct C-terminus compared to isoform a.