FGF13 (NM_001139501) Human Untagged Clone

CAT#: SC325627

FGF13 (untagged)-Human fibroblast growth factor 13 (FGF13), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FGF13
• Synonyms: FGF-13; FGF2; FHF-2; FHF2; LINC00889
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001139501, the custom clone sequence may differ by one or more nucleotides
  ATGTTACGACAAGATTCCATCCAATCTGCGGAATTAAAGAAAAAAGAGTCCCCCTTTCGT
  GCTAAGTGTCACGAAATCTTCTGCTGCCCGCTGAAGCAAGTACACCACAAAGAGAACACA
  GAGCCGGAAGAGCCTCAGCTTAAGGGTATAGTTACCAAGCTATACAGCCGACAAGGCTAC
  CACTTGCAGCTGCAGGCGGATGGAACCATTGATGGCACCAAAGATGAGGACAGCACTTAC
  ACTCTGTTTAACCTCATCCCTGTGGGTCTGCGAGTGGTGGCTATCCAAGGAGTTCAAACC
  AAGCTGTACTTGGCAATGAACAGTGAGGGATACTTGTACACCTCGGAACTTTTCACACCT
  GAGTGCAAATTCAAAGAATCAGTGTTTGAAAATTATTATGTGACATATTCATCAATGATA
  TACCGTCAGCAGCAGTCAGGCCGAGGGTGGTATCTGGGTCTGAACAAAGAAGGAGAGATC
  ATGAAAGGCAACCATGTGAAGAAGAACAAGCCTGCAGCTCATTTTCTGCCTAAACCACTG
  AAAGTGGCCATGTACAAGGAGCCATCACTGCACGATCTCACGGAGTTCTCCCGATCTGGA
  AGCGGGACCCCAACCAAGAGCAGAAGTGTCTCTGGCGTGCTGAACGGAGGCAAATCCATG
  AGCCACAATGAATCAACG
  
• Restriction Sites: Please inquire
• ACCN: NM_001139501
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001139501.1, NP_001132973.1
• RefSeq Size: 2450 bp
• RefSeq ORF: 681 bp
• Locus ID: 2258
• Cytogenetics: Xq26.3-q27.1
• Protein Families: Secreted Protein
• Protein Pathways: MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
• Gene Summary: 'The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This gene is located in a region on chromosome X, which is associated with Borjeson-Forssman-Lehmann syndrome (BFLS), making it a possible candidate gene for familial cases of the BFLS, and for other syndromal and nonspecific forms of X-linked cognitive disability mapping to this region. Alternative splicing of this gene at the 5' end results in several transcript variants encoding different isoforms with different N-termini. [provided by RefSeq, Nov 2008]'
  Transcript Variant: This variant (3) contains four additional exons at the 5' end compared to transcript variant 1. This results in a slightly shorter isoform (3) with a different N-terminus compared to isoform 1. Variants 3 and 5 encode the same isoform.