AZI2 (NM_001134433) Human Untagged Clone

CAT#: SC325639

AZI2 (untagged)-Human 5-azacytidine induced 2 (AZI2), transcript variant 3


  "NM_001134433" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "AZI2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AZI2
Synonyms AZ2; NAP1; TILP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001134433, the custom clone sequence may differ by one or more nucleotides
ATGGATGCACTGGTAGAAGATGATATCTGTATTCTGAATCATGAAAAAGCCCATAAGAGA
GATACAGTGACTCCAGTTTCAATATATTCAGGAGATGAATCTGTTGCTTCCCATTTTGCT
CTTGTCACTGCATATGAAGACATCAAAAAACGACTTAAGGATTCAGAGAAAGAGAACTCT
TTGTTAAAGAAGAGAATAAGATTTTTGGAAGAAAAGCTAATAGCTCGATTTGAAGAAGAA
ACAAGTTCCGTGGGACGAGAACAAGTAAATAAGGCCTATCATGCATATCGAGAGGTTTGC
ATTGATAGAGATAATTTGAAGAGCAAACTGGACAAAATGAATAAAGACAACTCTGAATCT
TTGAAAGTATTGAATGAGCAGCTACAATCTAAAGAAGTAGAACTCCTCCAGCTGAGGACA
GAGGTGGAAACTCAGCAGGTGATGAGGAATTTAAATCCACCTTCATCAAACTGGGAGGTG
GAAAAGTTGAGCTGTGACCTGAAGATCCATGGTTTGGAACAAGAGCTGGAACTGATGAGG
AAAGAATGTAGCGATCTCAAAATAGAACTACAGAAAGCCAAACAAACGGATCCATATCAG
GAAGACAATCTGAAGAGCAGAGATCTCCAAAAACTAAGCATTTCAAGAGTATCTGTAGCA
CAGCCTGGAGTGCAGTGGCGCAATCATGGGATAGCA
Restriction Sites Please inquire     
ACCN NM_001134433
ORF Size 699 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001134433.1, NP_001127905.1
RefSeq Size 1456
RefSeq ORF 699
Locus ID 64343
Protein Pathways RIG-I-like receptor signaling pathway
Gene Summary AZI2, or NAP1, contributes to the activation of NFKB (see MIM 164011)-dependent gene expression by activating IKK-related kinases, such as NAK (TBK1; MIM 604834) (Fujita et al., 2003 [PubMed 14560022]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (c) has a distinct C-terminus and is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.