SMAD6 (NM_001142861) Human Untagged Clone

CAT#: SC325641

SMAD6 (untagged)-Human SMAD family member 6 (SMAD6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SMAD6
• Synonyms: AOVD2; HsT17432; MADH6; MADH7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142861, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCAGAATGGGCAAACCCATAGAGACACAAAAATCTCCGCCACCTCCCTACTCTCGGCTGTCTCCTC
  GCGACGAGTACAAGCCACTGGATCTGTCCGATTCCACATTGTCTTACACTGAAACGGAGGCTACCAACTC
  CCTCATCACTGCTCCGGGTGAATTCTCAGACGCCAGCATGTCTCCGGACGCCACCAAGCCGAGCCACTGG
  TGCAGCGTGGCGTACTGGGAGCACCGGACGCGCGTGGGCCGCCTCTATGCGGTGTACGACCAGGCCGTCA
  GCATCTTCTACGACCTACCTCAGGGCAGCGGCTTCTGCCTGGGCCAGCTCAACCTGGAGCAGCGCAGCGA
  GTCGGTGCGGCGAACGCGCAGCAAGATCGGCTTCGGCATCCTGCTCAGCAAGGAGCCCGACGGCGTGTGG
  GCCTACAACCGCGGCGAGCACCCCATCTTCGTCAACTCCCCGACGCTGGACGCGCCCGGCGGCCGCGCCC
  TGGTCGTGCGCAAGGTGCCCCCCGGCTACTCCATCAAGGTGTTCGACTTCGAGCGCTCGGGCCTGCAGCA
  CGCGCCCGAGCCCGACGCCGCCGACGGCCCCTACGACCCCAACAGCGTCCGCATCAGCTTCGCCAAGGGC
  TGGGGGCCCTGCTACTCCCGGCAGTTCATCACCTCCTGCCCCTGCTGGCTGGAGATCCTCCTCAACAACC
  CCAGATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142861
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001142861.2, NP_001136333.1
• RefSeq Size: 1293 bp
• RefSeq ORF: 708 bp
• Locus ID: 4091
• Cytogenetics: 15q22.31
• Protein Families: Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
• Protein Pathways: TGF-beta signaling pathway
• Gene Summary: 'The protein encoded by this gene belongs to the SMAD family of proteins, which are related to Drosophila 'mothers against decapentaplegic' (Mad) and C. elegans Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions in the negative regulation of BMP and TGF-beta/activin-signalling. Multiple transcript variants have been found for this gene.[provided by RefSeq, Sep 2014]'
  Transcript Variant: This variant uses a different exon at the 5' terminus, compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus with a truncated Mad homolog (MH)-1 domain, compared to isoform 1. The variant is also known as SMAD6s.