NECAP2 (NM_001145278) Human Untagged Clone

CAT#: SC325645

NECAP2 (untagged)-Human NECAP endocytosis associated 2 (NECAP2), transcript variant 3


  "NM_001145278" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NECAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NECAP2
Synonyms FLJ10420
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145278, the custom clone sequence may differ by one or more nucleotides


ATGGAGGAGAGCGGGGCTGCGGAGTGGCAGCTGGACCAGCCATCATGGAGTGGCCGGCTGAGGATCACTG
CAAAGGGACAGATGGCCTACATCAAGCTGGAGGACAGGACGTCAGGGGAGCTCTTTGCTCAGGCCCCGGT
GGATCAGTTTCCTGGCACAGCTGTGGAGAGTGTGACGGATTCCAGCAGGTACTTCGTGATCCGCATCGAA
GATGGAAATGGGCGACGGGCGTTTATTGGAATTGGCTTCGGGGACCGAGGTGATGCCTTTGACTTCAATG
TTGCATTGCAGGACCATTTCAAGTGGGTGAAACAGCAGTGTGAATTTGCAAAACAAGCCCAGAACCCAGA
CCAAGGCCCTAAACTGGACCTGGGCTTCAAGGAGGGCCAGACCATCAAGCTCAACATCGCAAACATGAAG
AAGAAGGAAGGAGCAGCTGGGAATCCCCGAGTCCGGCCTGCCAGCACAGGAGGGCTGAGCCTGCTTCCCC
CTCCCCCAGGGGGGAAAACCTCCACCCTGATCCCTCCCCCTGGGGAGCAGTTGGCTGTGGGGGGATCCCT
CGTCCAGCCAGCAGTTGCTCCCAGTTCAGGAGGTGCTCCTGTACCCTGGCCACAGCCCAATCCTGCCACT
GCTGACATCTGGGGAGACTTTACCAAATCTACAGGATCAACTTCCAGCCAGACCCAGCCAGGCACAGGCT
GGGTCCAGTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001145278
ORF Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145278.1, NP_001138750.1
RefSeq Size 2014
RefSeq ORF 714
Locus ID 55707
Gene Summary This gene likely encodes a member of the adaptin-ear-binding coat-associated protein family. Studies of a similar protein in rat suggest a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. This results in a shorter protein (isoform 3) compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.