RABL2B (NM_001130923) Human Untagged Clone

CAT#: SC325647

RABL2B (untagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 7


  "NM_001130923" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RABL2B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RABL2B
Synonyms FLJ93981; FLJ98216
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001130923, the custom clone sequence may differ by one or more nucleotides


ATGGCAGAAGACAAAACCAAACCGAGTGAGTTGGACCAAGGGAAGTATGATGCTGATGACAACGTGAAGA
TCATCTGCCTGGGAGACAGCGCAGTGGGCAAATCCAAACTCATGGAGAGATTTCTCATGGATGGCTTTCA
GCCACAGCAGCTGTCCACGTACGCCCTGACCCTGTACAAGCACACAGCCACGGTAGATGGAAGGACCATC
CTTGTGGACTTTTGGGACACGGCAGGCCAGGAGCGGTTCCAGAGCATGCATGCCTCCTACTACCACAAGG
CCCACGCCTGCATCATGGTGTTTGATGTACAGAGGAAAGTCACCTATAGGAACCTGAGCACCTGGTATAC
AGAGCTTCGGGAGTTCAGGCCAGAGATCCCATGCATCGTGGTGGCCAATAAAATTGATGACATAAACGTG
ACCCAAAAAAGCTTCAATTTTGCCAAGAAGTTCTCCCTGCCCCTGTATTTCGTCTCGGCTGCTGATGGTA
CCAATGTTGTGAAGGTGTGGTTGACTGCAGAGGTAGCTAGCAAGCTCTTCAATGATGCAATTCGATTAGC
TGTGTCTTACAAACAGAACTCCCAGGACTTCATGGATGAGATTTTTCAGGAGCTCGAGAACTTCAGCTTG
GAGCAGGAAGAGGAGGACGTGCCAGACCAGGAACAGAGCAGCAGCATCGAGACCCCATCAGAGGAGGCGG
CCTCTCCCCACAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001130923
ORF Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001130923.1, NP_001124395.1
RefSeq Size 2372
RefSeq ORF 717
Locus ID 11158
Protein Families Druggable Genome
Gene Summary The RABL2B protein is a member of the RAB gene family which belongs to the RAS GTPase superfamily. RABL2B is located within a subtelomeric region of 22q13.3. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (7) encodes isoform 3. Variants 7, 18, 19 and 20 all encode the same isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.