ADTRP (NM_001143948) Human Untagged Clone
CAT#: SC325660
ADTRP (untagged)-Human chromosome 6 open reading frame 105 (C6orf105), transcript variant 1
"NM_001143948" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ADTRP |
Synonyms | AIG1L; C6orf105; dJ413H6.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001143948, the custom clone sequence may differ by one or more nucleotides
ATGACGAAGACTTCTACATGCATATACCACTTCCTTGTTCTGAGCTGGTATACTTTCCTCAATTATTACA TCTCACAGGAAGGAAAAGACGAGGTGAAACCCAAAATCTTGGCAAATGGTGCAAGGTGGAAATATATGAC GCTGCTTAATCTGCTCAAGAACAGGACTGCTGGGTTTGACATCTACCAGCCAGGAAGCTTTAGGCAGCTC TTGCAGACCATTTTCTACGGGGTCACCTGCCTGGATGATGTGCTGAAAAGAACCAAAGGGGGAAAAGACA TTAAGTTCCTAACTGCCTTCAGAGACCTGCTTTTCACCACTCTGGCTTTTCCTGTATCCACGTTTGTATT TTTGGCATTCTGGATCCTCTTTCTCTACAATCGAGATCTCATTTACCCCAAGGTCCTAGATACTGTCATC CCCGTGTGGCTGAATCATGCAATGCACACTTTCATATTCCCCATCACATTGGCTGAAGTCGTCCTCAGGC CTCACTCCTATCCATCAAAGAAGACAGGACTCACCTTGCTGGCTGCTGCCAGCATTGCTTACATCAGCCG CATCCTATGGCTCTACTTTGAGACGGGTACCTGGGTGTATCCTGTGTTTGCCAAACTCAGCCTCTTGGGT CTAGCAGCTTTCTTCTCTCTCAGCTACGTCTTCATCGCCAGCATCTACCTACTTGGAGAGAAGCTCAACC ACTGGAAATGGGGTGACATGAGGCAGCCACGGAAGAAGAGGAAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001143948 |
ORF Size | 747 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001143948.1, NP_001137420.1 |
RefSeq Size | 1866 |
RefSeq ORF | 747 |
Locus ID | 84830 |
Protein Families | Transmembrane |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227468 | ADTRP (Myc-DDK-tagged)-Human chromosome 6 open reading frame 105 (C6orf105), transcript variant 1 |
USD 420.00 |
|
RG227468 | ADTRP (GFP-tagged) - Human chromosome 6 open reading frame 105 (C6orf105), transcript variant 1 |
USD 460.00 |
|
RC227468L1 | Lenti-ORF clone of ADTRP (Myc-DDK-tagged)-Human chromosome 6 open reading frame 105 (C6orf105), transcript variant 1 |
USD 768.00 |
|
RC227468L2 | Lenti-ORF clone of ADTRP (mGFP-tagged)-Human chromosome 6 open reading frame 105 (C6orf105), transcript variant 1 |
USD 620.00 |
|
RC227468L3 | Lenti-ORF clone of ADTRP (Myc-DDK-tagged)-Human chromosome 6 open reading frame 105 (C6orf105), transcript variant 1 |
USD 620.00 |
|
RC227468L4 | Lenti-ORF clone of ADTRP (mGFP-tagged)-Human chromosome 6 open reading frame 105 (C6orf105), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review