EIF4E (NM_001130679) Human Untagged Clone

CAT#: SC325662

EIF4E (untagged)-Human eukaryotic translation initiation factor 4E (EIF4E), transcript variant 2


  "NM_001130679" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "EIF4E"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EIF4E
Synonyms AUTS19; CBP; eIF-4E; EIF4E1; EIF4EL1; EIF4F
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001130679 edited
ATGGCGACTGTCGAACCGGAAACCACCCCTACTCCTAATCCCCCGACTACAGAAGAGGAG
AAAACGGAATCTAATCAGGAGGTTGCTAACCCAGAACACTATATTAAACATCCCCTACAG
AACAGATGGGCACTCTGGTTTTTTAAAAATGATAAAAGCAAAACTTGGCAAGCAAACCTG
CGGCTGATCTCCAAGTTTGATACTGTTGAAGACTTTTGGGCTCTGTACAACCATATCCAG
TTGTCTAGTAATTTAATGCCTGGCTGTGACTACTCACTTTTTAAGGATGGTATTGAGCCT
ATGTGGGAAGATGAGAAAAACAAACGGGGAGGACGATGGCTAATTACATTGAACAAACAG
CAGAGACGAAGTGACCTCGATCGCTTTTGGCTAGAGACAAGATGGGATCTTGCTATGTTG
CCCAGGTTGGTCTCAAACTTCTGGCCTCAAGTGATCCTCCCACTTCAGCCTCCCAAAGTG
CTGGAATTACAGCTTCTGTGCCTTATTGGAGAATCTTTTGATGACTACAGTGATGATGTA
TGTGGCGCTGTTGTTAATGTTAGAGCTAAAGGTGATAAGATAGCAATATGGACTACTGAA
TGTGAAAACAGAGAAGCTGTTACACATATAGGGAGGGTATACAAGGAAAGGTTAGGACTT
CCTCCAAAGATAGTGATTGGTTATCAGTCCCACGCAGACACAGCTACTAAGAGCGGCTCC
ACCACTAAAAATAGGTTTGTTGTTTAA
Restriction Sites Please inquire     
ACCN NM_001130679
Insert Size 3300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130679.1, NP_001124151.1
RefSeq Size 4842 bp
RefSeq ORF 747 bp
Locus ID 1977
Cytogenetics 4q23
Protein Pathways Insulin signaling pathway, mTOR signaling pathway
Gene Summary 'The protein encoded by this gene is a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]'
Transcript Variant: This variant (2) contains an alternate in-frame exon in the 3' coding region compared to variant 1. It encodes isoform 2, which is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because transcript sequence consistent with the reference genome assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.