RNASEH2B (NM_001142279) Human Untagged Clone

CAT#: SC325676

RNASEH2B (untagged)-Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNASEH2B
• Synonyms: AGS2; DLEU8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142279, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCGCTGGCGTGGACTGCGGGGACGGGGTTGGCGCCCGGCAGCACGTGTTCCTGGTTTCAGAATATT
  TAAAAGATGCTTCAAAGAAGATGAAAAATGGGCTAATGTTTGTAAAACTGGTTAACCCCTGTTCAGGAGA
  AGGAGCCATTTACTTGTTCAATATGTGTCTACAGCAGCTGTTTGAAGTAAAAGTTTTCAAGGAAAAACAC
  CATTCTTGGTTTATAAATCAATCAGTTCAATCAGGAGGTCTTCTCCATTTTGCCACACCTGTGGATCCTC
  TATTTCTGCTTCTCCACTACCTCATAAAGGCTGATAAGGAGGGGAAGTTTCAGCCCCTTGATCAAGTTGT
  GGTGGATAACGTGTTTCCAAATTGCATCTTGTTGCTGAAACTTCCTGGACTTGAGAAGTTACTTCATCAT
  GTGACAGAGGAAAAAGGTAATCCAGAAATAGACAACAAGAAATATTACAAGTACAGCAAAGAGAAGACAT
  TAAAGTGGCTGGAAAAAAAGGTTAATCAAACTGTGGCAGCATTAAAAACCAATAATGTGAATGTCAGTTC
  CCGGGTACAGTCAACTGCATTTTTCTCTGGTGACCAAGCTTCCACTGACAAGGAAGAGGATTATATTCGT
  TATGCCCATGGTCTGATATCTGACTACATCCCTAAAGAATTAAGTGATGACTTATCTAAATACTTAAAGC
  TTCCAGAACCTTCAGCCTCATTGCCAAATCCTCCATCAAAGATGGCAGCACAAAGACAGAAAAGGGGCAA
  GTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142279
• ORF Size: 774 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142279.2, NP_001135751.1
• RefSeq Size: 1685
• RefSeq ORF: 774
• Locus ID: 79621
• Protein Pathways: DNA replication
• Gene Summary: RNase H2 is composed of a single catalytic subunit (A) and two non-catalytic subunits (B and C) and specifically degrades the RNA of RNA:DNA hybrids. The protein encoded by this gene is the non-catalytic B subunit of RNase H2, which is thought to play a role in DNA replication. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Aicardi-Goutieres syndrome type 2 (AGS2). [provided by RefSeq, Nov 2008]
  Transcript Variant: This variant (2) uses an alternate splice pattern in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1.