ABHD11 (NM_001145364) Human Untagged Clone

CAT#: SC325677

ABHD11 (untagged)-Human abhydrolase domain containing 11 (ABHD11), nuclear gene encoding mitochondrial protein, transcript variant 8


  "NM_001145364" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ABHD11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ABHD11
Synonyms PP1226; WBSCR21
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001145364, the custom clone sequence may differ by one or more nucleotides
ATGCGAGCCGGCCAACAGCTTGCAAGCATGCTCCGCTGGACCCGAGCCTGGAGGCTCCCG
CGTGAGGGACTCGGCCCCCACGGCCCTAGCTTCGCGAGGGTGCCTGTCGCACCCAGCAGC
AGCAGCGGCGGCCGAGGGGGCGCCGAGCCGAGGCCGCTTCCGCTTTCCTACAGGCTTCTG
GACGGGGAGGCAGCCCTCCCGGCCGTCGTCTTTTTGCACGGGCTCTTCGGCAGCAAAACT
AACTTCAACTCCATCGCCAAGATCTTGGCCCAGCAGACAGGCCGTAGGGTGCTGACGGTG
GATGCTCGTAACCACGGTGACAGCCCCCACAGCCCAGACATGAGCTACGAGATCATGAGC
CAGGACCTGCAGGACCTTCTGCCCCAGCTGGGCCTGGTGCCCTGCGTCGTCGTTGGCCAC
AGCATGGGAGGAAAGACAGCCATGCTGCTGGCACTACAGAGGGACATGGCCGTGCGGCAG
CACCTGCTCACTAACCTGGTAGAGGTAGACGGGCGCTTCGTGTGGAGGGTGAACTTGGAT
GCCCTGACCCAGCACCTAGACAAGATCTTGGCTTTCCCACAGAGGCAGGAGTCCTACCTC
GGGCCAACACTCTTTCTCCTTGGTGGAAACTCCCAGTTCGTGCATCCCAGCCACCACCCT
GAGATTATGCGGCTCTTCCCTCGGGCCCAGATGCAGACGGTGCCGAACGCTGGCCACTGG
ATCCACGCTGACCGCCCACAGGACTTCATAGCTGCCATCCGAGGCTTCCTGGTC
Restriction Sites Please inquire     
ACCN NM_001145364
ORF Size 777 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145364.1, NP_001138836.1
RefSeq Size 1300
RefSeq ORF 777
Locus ID 83451
Gene Summary This gene encodes a protein containing an alpha/beta hydrolase fold domain. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (8) lacks a coding exon, compared to variant 1, resulting in a shorter protein (isoform 8).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.