alpha Sarcoglycan (SGCA) (NM_001135697) Human Untagged Clone

CAT#: SC325682

SGCA (untagged)-Human sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) (SGCA), transcript variant 2


  "NM_001135697" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SGCA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SGCA
Synonyms 50DAG; adhalin; ADL; DAG2; DMDA2; LGMD2D; LGMDR3; SCARMD1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001135697, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGACACTCTTCTGGACTCCTCTCCTCGTGGTTCTCCTGGCAGGGCTGGGGGAC
ACCGAGGCCCAGCAGACCACGCTACACCCACTTGTGGGCCGTGTCTTTGTGCACACCTTG
GACCATGAGACGTTTCTGAGCCTTCCTGAGCATGTCGCTGTCCCACCCGCTGTCCACATC
ACCTACCACGCCCACCTCCAGGGACACCCAGACCTGCCCCGGTGGCTCCGCTACACCCAG
CGCAGCCCCCACCACCCTGGCTTCCTCTACGGCTCTGCCACCCCAGAAGATCGTGGGCTC
CAGGTCATTGAGGTCACAGCCTACAATCGGGACAGCTTTGATACCACTCGGCAGAGGCTG
GTGCTGGAGATTGGGGACCCAGAAGGCCCCCTGCTGCCATACCAAGCCGAGTTCCTGGTG
CGCAGCCACGATGCGGAGGAGGTGCTGCCCTCAACACCTGCCAGCCGCTTCCTCTCAGCC
TTGGGGGGACTCTGGGAGCCCGGAGAGCTTCAGCTGCTCAACGTCACCTCTGCCTTGGAC
CGTGGGGGCCGTGTCCCCCTTCCCATTGAGGGCCGAAAAGAAGGGCTGAAGAGAGACCTG
GCTACCTCCGACATCCAGATGGTCCACCACTGCACCATCCACGGGAACACAGAGGAGCTG
CGGCAGATGGCGGCCAGCCGCGAGGTGCCCCGGCCACTCTCCACCCTGCCCATGTTCAAT
GTGCACACAGGTGAGCGGCTGCCTCCCCGCGTGGACAGCGCCCAGGTGCCCCTCATTCTG
GACCAGCAC
Restriction Sites Please inquire     
ACCN NM_001135697
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135697.1, NP_001129169.1
RefSeq Size 1069 bp
RefSeq ORF 792 bp
Locus ID 6442
Cytogenetics 17q21.33
Protein Families Druggable Genome, Transmembrane
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), Viral myocarditis
Gene Summary 'This gene encodes a component of the dystrophin-glycoprotein complex (DGC), which is critical to the stability of muscle fiber membranes and to the linking of the actin cytoskeleton to the extracellular matrix. Its expression is thought to be restricted to striated muscle. Mutations in this gene result in type 2D autosomal recessive limb-girdle muscular dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]'
Transcript Variant: This variant (2) lacks two alternate in-frame exons in the central coding region, compared to variant 1. The resulting isoform (2) lacks a segment of the sarcoglycan domain including the transmembrane domain, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.