LGALS12 (NM_001142538) Human Untagged Clone

CAT#: SC325685

LGALS12 (untagged)-Human lectin, galactoside-binding, soluble, 12 (LGALS12), transcript variant 5


  "NM_001142538" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LGALS12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LGALS12
Synonyms GAL12; GRIP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001142538, the custom clone sequence may differ by one or more nucleotides


ATGGTCATGCTGCAAGGAGTGGTCCCTCTAGATGCACACAGGTTTCAGGTGGACTTCCAGTGTGGCTGCA
GCCTGTGTCCCCGGCCAGATATCGCCTTCCACTTCAACCCTCGCTTCCATACCACCAAGCCCCATGTCAT
CTGCAACACCCTGCATGGTGGACGCTGGCAAAGGGAGGCCCGGTGGCCCCACCTGGCCCTGCGAAGAGGC
TCCAGCTTCCTCATCCTCTTTCTCTTCGGGAATGAGGAAGTGAAGGTGAGTGTGAATGGACAGCACTTTC
TCCACTTCCGCTACCGGCTCCCACTGTCTCATGTGGACACGCTGGGTATATTTGGTGACATCCTGGTAGA
GGCTGTTGGATTCCTGAACATCAATCCATTTGTGGAGGGCAGCAGAGAGTACCCAGCTGGACATGAGGTG
CCCTGCTCACATGCTCTTCCCCAGGGTCTCTCGCCTGGGCAGGTCATCATAGTACGGGGACTGGTCTTGC
AAGAGCCGAAGCATTTTACTGTGAGCCTGAGGGACCAGGCTGCCCATGCTCCTGTGACACTCAGGGCCTC
CTTCGCAGACAGAACTCTGGCCTGGATCTCCCGCTGGGGGCAGAAGAAACTGATCTCAGCCCCCTTCCTC
TTTTACCCCCAGAGATTCTTTGAGGTGCTGCTCCTGTTCCAGGAGGGAGGGCTGAAGCTGGCGCTCAATG
GGCAGGGGCTGGGGGCCACCAGCATGAACCAGCAGGCCCTGGAGCAGCTGCGGGAGCTCCGGATCAGTGG
AAGTGTCCAGCTCTACTGTGTCCACTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001142538
ORF Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001142538.1, NP_001136010.1
RefSeq Size 1796
RefSeq ORF 801
Locus ID 85329
Gene Summary This gene encodes a member of the galectin superfamily, a group of beta-galactoside-binding proteins with conserved carbohydrate recognition domains. The related mouse protein is a primary regulator of the early stages of adipose tissue development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, May 2010]
Transcript Variant: This variant (5) differs in the 5' UTR, uses an alternate in-frame splice site in the 5' coding region, lacks a coding exon, and initiates translation from a downstream start codon, compared to variant 1. The resulting protein (isoform 5) is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.